Incidental Mutation 'R5073:Kif1a'
ID388936
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Namekinesin family member 1A
SynonymsLOC381283, N-3 kinesin, ATSV, C630002N23Rik, Kns1
MMRRC Submission 042662-MU
Accession Numbers

Genbank: NM_008440.3, NM_001110315.1

Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R5073 (G1)
Quality Score103
Status Validated
Chromosome1
Chromosomal Location93015464-93101951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93022505 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1400 (H1400R)
Ref Sequence ENSEMBL: ENSMUSP00000128432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
Predicted Effect probably damaging
Transcript: ENSMUST00000086819
AA Change: H1401R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: H1401R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112958
AA Change: H1401R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: H1401R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171556
AA Change: H1392R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: H1392R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171796
AA Change: H1400R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: H1400R

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188136
Predicted Effect probably damaging
Transcript: ENSMUST00000190723
AA Change: H1494R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: H1494R

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190854
Meta Mutation Damage Score 0.4395 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 93054934 missense probably damaging 1.00
IGL01574:Kif1a APN 1 93082340 missense probably damaging 1.00
IGL01637:Kif1a APN 1 93039853 missense possibly damaging 0.95
IGL01895:Kif1a APN 1 93025733 missense possibly damaging 0.65
IGL02215:Kif1a APN 1 93020549 missense probably benign 0.05
IGL02571:Kif1a APN 1 93020456 critical splice donor site probably null
IGL02734:Kif1a APN 1 93062558 missense probably damaging 1.00
IGL02752:Kif1a APN 1 93039847 missense possibly damaging 0.92
IGL02990:Kif1a APN 1 93039263 missense probably damaging 1.00
IGL03298:Kif1a APN 1 93066181 missense probably damaging 1.00
IGL03309:Kif1a APN 1 93058857 nonsense probably null
IGL03354:Kif1a APN 1 93060235 missense probably damaging 1.00
asbestos UTSW 1 93022505 missense probably damaging 1.00
chrysolite UTSW 1 93074948 splice site probably benign
osmium UTSW 1 93058810 splice site probably benign
R4538_Kif1a_397 UTSW 1 93077047 missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93077068 missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93082406 missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 93046729 missense probably damaging 1.00
R0025:Kif1a UTSW 1 93042358 missense probably damaging 1.00
R0115:Kif1a UTSW 1 93046778 splice site probably benign
R0243:Kif1a UTSW 1 93042093 missense probably damaging 1.00
R0270:Kif1a UTSW 1 93054442 splice site probably benign
R0335:Kif1a UTSW 1 93052566 splice site probably benign
R0380:Kif1a UTSW 1 93056031 critical splice acceptor site probably null
R0472:Kif1a UTSW 1 93018997 missense probably damaging 0.99
R0501:Kif1a UTSW 1 93056245 missense probably damaging 1.00
R0538:Kif1a UTSW 1 93043638 missense probably damaging 0.99
R0628:Kif1a UTSW 1 93019883 missense probably damaging 1.00
R0848:Kif1a UTSW 1 93019898 missense probably damaging 1.00
R1110:Kif1a UTSW 1 93023453 splice site probably benign
R1132:Kif1a UTSW 1 93056021 missense probably damaging 0.99
R1387:Kif1a UTSW 1 93055950 splice site probably benign
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1466:Kif1a UTSW 1 93054929 missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93074948 splice site probably benign
R1569:Kif1a UTSW 1 93058810 splice site probably benign
R1802:Kif1a UTSW 1 93066149 missense probably damaging 1.00
R1917:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1919:Kif1a UTSW 1 93019031 missense possibly damaging 0.95
R1999:Kif1a UTSW 1 93060795 missense probably damaging 0.98
R2000:Kif1a UTSW 1 93054329 missense probably damaging 0.99
R2276:Kif1a UTSW 1 93068477 splice site probably benign
R2307:Kif1a UTSW 1 93078769 missense probably damaging 1.00
R2919:Kif1a UTSW 1 93046742 missense probably damaging 1.00
R3440:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3441:Kif1a UTSW 1 93036853 missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93077043 missense probably null 1.00
R3957:Kif1a UTSW 1 93025694 missense probably damaging 1.00
R4010:Kif1a UTSW 1 93022409 missense probably benign 0.42
R4013:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4017:Kif1a UTSW 1 93076292 missense probably damaging 1.00
R4115:Kif1a UTSW 1 93052538 missense probably damaging 1.00
R4386:Kif1a UTSW 1 93068550 missense probably damaging 1.00
R4538:Kif1a UTSW 1 93077047 missense probably damaging 1.00
R4608:Kif1a UTSW 1 93024646 missense possibly damaging 0.81
R4625:Kif1a UTSW 1 93042659 missense probably benign 0.00
R4701:Kif1a UTSW 1 93078835 missense probably damaging 0.99
R4794:Kif1a UTSW 1 93025727 missense probably damaging 1.00
R4830:Kif1a UTSW 1 93021209 splice site probably null
R4903:Kif1a UTSW 1 93021734 missense probably damaging 1.00
R4915:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4918:Kif1a UTSW 1 93074978 missense probably benign 0.21
R4991:Kif1a UTSW 1 93078808 missense probably benign 0.00
R5028:Kif1a UTSW 1 93054327 missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93076154 splice site probably null
R5103:Kif1a UTSW 1 93046696 missense probably damaging 1.00
R5314:Kif1a UTSW 1 93018498 missense probably damaging 1.00
R5481:Kif1a UTSW 1 93060244 missense probably benign 0.01
R5510:Kif1a UTSW 1 93041692 missense possibly damaging 0.93
R5610:Kif1a UTSW 1 93025728 missense probably damaging 1.00
R5643:Kif1a UTSW 1 93055767 missense probably damaging 0.98
R5808:Kif1a UTSW 1 93042698 missense probably damaging 0.99
R6027:Kif1a UTSW 1 93025643 missense probably benign 0.33
R6056:Kif1a UTSW 1 93024648 missense probably damaging 1.00
R6077:Kif1a UTSW 1 93054896 missense possibly damaging 0.54
R6120:Kif1a UTSW 1 93024574 splice site probably null
R6126:Kif1a UTSW 1 93019899 missense probably damaging 1.00
R6130:Kif1a UTSW 1 93036901 missense probably damaging 1.00
R6255:Kif1a UTSW 1 93019983 missense probably damaging 1.00
R6301:Kif1a UTSW 1 93054941 nonsense probably null
R6326:Kif1a UTSW 1 93076326 missense probably damaging 1.00
R6594:Kif1a UTSW 1 93021313 missense probably benign 0.00
R6653:Kif1a UTSW 1 93077698 missense probably damaging 1.00
R6791:Kif1a UTSW 1 93066137 missense probably damaging 1.00
R6853:Kif1a UTSW 1 93039802 missense possibly damaging 0.47
R7022:Kif1a UTSW 1 93066098 missense probably benign 0.31
R7059:Kif1a UTSW 1 93046829 intron probably benign
R7103:Kif1a UTSW 1 93077785 missense probably damaging 1.00
R7248:Kif1a UTSW 1 93041583 missense probably benign 0.35
R7259:Kif1a UTSW 1 93073810 nonsense probably null
R7424:Kif1a UTSW 1 93054317 missense possibly damaging 0.89
R7659:Kif1a UTSW 1 93046820 intron probably benign
R7681:Kif1a UTSW 1 93054944 missense probably benign
R7976:Kif1a UTSW 1 93039774 missense probably damaging 1.00
R8056:Kif1a UTSW 1 93054701 intron probably benign
R8420:Kif1a UTSW 1 93022419 missense probably benign
Z1176:Kif1a UTSW 1 93021316 missense probably damaging 0.97
Z1176:Kif1a UTSW 1 93022491 missense probably damaging 1.00
Z1176:Kif1a UTSW 1 93055697 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAAAGCCGTGGTCACATC -3'
(R):5'- ATAGGCAGGACGTCTGAGTC -3'

Sequencing Primer
(F):5'- TACCTTGACAGCCAGCTCC -3'
(R):5'- TCTGAGTCCTGCCAGCAGTG -3'
Posted On2016-06-06