Incidental Mutation 'R5073:Olfr1100'
ID388942
Institutional Source Beutler Lab
Gene Symbol Olfr1100
Ensembl Gene ENSMUSG00000070875
Gene Nameolfactory receptor 1100
SynonymsGA_x6K02T2Q125-48465387-48464422, MOR206-4
MMRRC Submission 042662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5073 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86976029-86979954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86978322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 158 (V158D)
Ref Sequence ENSEMBL: ENSMUSP00000151088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094913] [ENSMUST00000117211]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094913
AA Change: V158D

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092517
Gene: ENSMUSG00000070875
AA Change: V158D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 314 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117211
AA Change: V158D

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.5106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Olfr1100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Olfr1100 APN 2 86977849 nonsense probably null
R0102:Olfr1100 UTSW 2 86978205 missense possibly damaging 0.90
R0477:Olfr1100 UTSW 2 86978223 missense probably damaging 0.99
R0586:Olfr1100 UTSW 2 86978782 missense probably damaging 0.99
R0743:Olfr1100 UTSW 2 86978499 missense probably benign 0.12
R1163:Olfr1100 UTSW 2 86978676 missense probably damaging 1.00
R1640:Olfr1100 UTSW 2 86978619 missense probably damaging 1.00
R2865:Olfr1100 UTSW 2 86978461 missense possibly damaging 0.56
R4478:Olfr1100 UTSW 2 86978218 missense probably benign
R4548:Olfr1100 UTSW 2 86978670 missense probably damaging 0.98
R4618:Olfr1100 UTSW 2 86978274 missense possibly damaging 0.87
R4829:Olfr1100 UTSW 2 86978574 missense probably damaging 0.99
R4858:Olfr1100 UTSW 2 86978349 missense probably damaging 1.00
R5071:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5072:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5074:Olfr1100 UTSW 2 86978322 missense possibly damaging 0.88
R5574:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R5735:Olfr1100 UTSW 2 86978700 missense probably benign 0.08
R5874:Olfr1100 UTSW 2 86978442 missense probably damaging 0.99
R6228:Olfr1100 UTSW 2 86978691 missense probably damaging 1.00
R6689:Olfr1100 UTSW 2 86978154 missense probably benign 0.36
R6979:Olfr1100 UTSW 2 86978233 missense probably damaging 1.00
R7006:Olfr1100 UTSW 2 86977959 missense probably damaging 0.99
R7274:Olfr1100 UTSW 2 86978523 missense probably benign 0.00
R7399:Olfr1100 UTSW 2 86978157 missense probably benign 0.19
R7560:Olfr1100 UTSW 2 86978778 missense probably benign 0.00
R7765:Olfr1100 UTSW 2 86978194 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTGGAGAAGGCTTTGTGC -3'
(R):5'- ACAGAATCTGCTGACTTCCAC -3'

Sequencing Primer
(F):5'- TAGACACATAGGATGCAGATATTGTG -3'
(R):5'- GAATCTGCTGACTTCCACAAAAG -3'
Posted On2016-06-06