Incidental Mutation 'R0433:Camk1g'
Institutional Source Beutler Lab
Gene Symbol Camk1g
Ensembl Gene ENSMUSG00000016179
Gene Namecalcium/calmodulin-dependent protein kinase I gamma
SynonymsCLICK-III, CaMKIgamma
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R0433 (G1)
Quality Score216
Status Validated
Chromosomal Location193346346-193370298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193354058 bp
Amino Acid Change Phenylalanine to Leucine at position 165 (F165L)
Ref Sequence ENSEMBL: ENSMUSP00000016323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016323] [ENSMUST00000169907]
Predicted Effect probably damaging
Transcript: ENSMUST00000016323
AA Change: F165L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016323
Gene: ENSMUSG00000016179
AA Change: F165L

S_TKc 23 277 9.53e-112 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163202
AA Change: F111L
SMART Domains Protein: ENSMUSP00000131451
Gene: ENSMUSG00000016179
AA Change: F111L

S_TKc 2 238 5.19e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165718
Predicted Effect probably damaging
Transcript: ENSMUST00000169907
AA Change: F165L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128143
Gene: ENSMUSG00000016179
AA Change: F165L

S_TKc 23 277 9.53e-112 SMART
Meta Mutation Damage Score 0.9117 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Camk1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camk1g APN 1 193347349 unclassified probably benign
IGL02637:Camk1g APN 1 193348388 missense probably benign 0.38
I2288:Camk1g UTSW 1 193351106 splice site probably benign
R0375:Camk1g UTSW 1 193356401 splice site probably benign
R0967:Camk1g UTSW 1 193350296 missense probably damaging 1.00
R1161:Camk1g UTSW 1 193348354 missense probably benign
R1227:Camk1g UTSW 1 193347433 missense possibly damaging 0.73
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1641:Camk1g UTSW 1 193356357 missense probably benign 0.25
R3109:Camk1g UTSW 1 193354993 missense probably damaging 1.00
R3160:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3161:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R4638:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4642:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4644:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4756:Camk1g UTSW 1 193362085 missense probably benign 0.03
R4781:Camk1g UTSW 1 193356344 missense probably benign 0.00
R4987:Camk1g UTSW 1 193348475 missense probably damaging 0.99
R5224:Camk1g UTSW 1 193355034 missense probably damaging 1.00
R5407:Camk1g UTSW 1 193347372 unclassified probably null
R5932:Camk1g UTSW 1 193354039 missense probably benign 0.25
R6725:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
R7071:Camk1g UTSW 1 193359809 missense probably benign 0.10
R7808:Camk1g UTSW 1 193350285 missense possibly damaging 0.51
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgatgtgagatgtgatacccag -3'
Posted On2013-05-23