Incidental Mutation 'R5073:Cit'
ID 388965
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Name citron
Synonyms CRIK-SK, C030025P15Rik, citron kinase, Cit-k, citron-N
MMRRC Submission 042662-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R5073 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 115983337-116147006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116084902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 811 (M811K)
Ref Sequence ENSEMBL: ENSMUSP00000099620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051704
AA Change: M811K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: M811K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
AA Change: M811K

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: M811K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
AA Change: M769K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: M769K

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147479
Predicted Effect probably benign
Transcript: ENSMUST00000141101
AA Change: M769K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: M769K

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Meta Mutation Damage Score 0.1254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Adcy8 A T 15: 64,659,207 (GRCm39) W528R probably damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Ahnak T A 19: 8,980,595 (GRCm39) H626Q probably benign Het
Ampd2 A T 3: 107,986,549 (GRCm39) M245K probably damaging Het
Apob G A 12: 8,055,219 (GRCm39) probably null Het
Apool C T X: 111,259,540 (GRCm39) Q60* probably null Het
Aqp1 A T 6: 55,322,520 (GRCm39) I172F probably damaging Het
Atp7a A G X: 105,153,374 (GRCm39) D1092G probably benign Het
Bcas3 A G 11: 85,261,958 (GRCm39) Y110C probably damaging Het
Brpf1 T C 6: 113,287,215 (GRCm39) S148P probably damaging Het
Capn3 A G 2: 120,322,301 (GRCm39) H339R probably damaging Het
Ccdc141 A T 2: 76,954,722 (GRCm39) probably null Het
Ccl2 A G 11: 81,927,984 (GRCm39) probably benign Het
Cct8l1 G A 5: 25,721,881 (GRCm39) V199I probably benign Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Crim1 T C 17: 78,588,776 (GRCm39) C284R possibly damaging Het
Cyp2d10 C T 15: 82,287,954 (GRCm39) R383H probably benign Het
Cyp4a29 A G 4: 115,104,860 (GRCm39) T123A probably benign Het
Dbndd2 A G 2: 164,332,224 (GRCm39) probably benign Het
Dnaja3 A T 16: 4,514,289 (GRCm39) T274S probably damaging Het
Dot1l A G 10: 80,620,480 (GRCm39) D514G possibly damaging Het
Dysf A T 6: 84,114,254 (GRCm39) K1226M probably damaging Het
Eef1akmt1 A G 14: 57,803,464 (GRCm39) L30P probably damaging Het
Elavl1 A G 8: 4,351,741 (GRCm39) M125T possibly damaging Het
Eml4 C A 17: 83,771,006 (GRCm39) S723R probably damaging Het
Fgf15 A C 7: 144,450,576 (GRCm39) Y54S possibly damaging Het
Fign A T 2: 63,810,037 (GRCm39) L411* probably null Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Fryl G A 5: 73,232,110 (GRCm39) P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gprasp2 C T X: 134,743,346 (GRCm39) T235I possibly damaging Het
H2ab3 T C X: 119,222,543 (GRCm39) T84A probably damaging Het
Hal A T 10: 93,349,904 (GRCm39) I555F probably damaging Het
Hdac6 A G X: 7,811,036 (GRCm39) F104L probably damaging Het
Hibadh C T 6: 52,597,079 (GRCm39) V122M possibly damaging Het
Hmga1b C T 11: 120,654,012 (GRCm39) Q100* probably null Het
Hydin A G 8: 111,265,105 (GRCm39) N2763D probably benign Het
Ifi47 A G 11: 48,986,361 (GRCm39) T43A probably benign Het
Ifnlr1 A G 4: 135,432,457 (GRCm39) T298A probably benign Het
Impdh2 G A 9: 108,440,535 (GRCm39) probably null Het
Insr A G 8: 3,209,475 (GRCm39) F1203L probably damaging Het
Kcnq4 A G 4: 120,574,714 (GRCm39) S117P probably damaging Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Kif1a T C 1: 92,950,227 (GRCm39) H1400R probably damaging Het
Kiss1r C A 10: 79,754,596 (GRCm39) S30* probably null Het
Krt222 T A 11: 99,134,796 (GRCm39) probably benign Het
Lekr1 A T 3: 65,727,215 (GRCm39) noncoding transcript Het
Ltn1 A G 16: 87,224,628 (GRCm39) V32A probably damaging Het
Marchf1 T A 8: 66,839,020 (GRCm39) W21R probably benign Het
Marchf5 A G 19: 37,188,207 (GRCm39) N58S possibly damaging Het
Mast4 G A 13: 102,875,391 (GRCm39) Q1158* probably null Het
Mib2 C G 4: 155,741,233 (GRCm39) A535P probably damaging Het
Mrtfa A G 15: 80,906,627 (GRCm39) V91A probably damaging Het
Msc C T 1: 14,824,537 (GRCm39) V178M probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc5b A T 7: 141,412,999 (GRCm39) T1982S unknown Het
Mvk A T 5: 114,591,013 (GRCm39) probably benign Het
Myo1a T C 10: 127,543,288 (GRCm39) probably null Het
Myo6 T G 9: 80,195,290 (GRCm39) S887A probably benign Het
Myo7a G A 7: 97,722,425 (GRCm39) Q1167* probably null Het
Ncald A T 15: 37,397,478 (GRCm39) H67Q probably damaging Het
Nmnat1 C A 4: 149,553,595 (GRCm39) M172I probably benign Het
Nudt1 G T 5: 140,317,662 (GRCm39) probably null Het
Nudt5 T A 2: 5,869,198 (GRCm39) H141Q probably benign Het
Or1m1 T C 9: 18,666,118 (GRCm39) E271G possibly damaging Het
Or4e1 T A 14: 52,701,032 (GRCm39) M118L probably damaging Het
Or8h10 A T 2: 86,808,666 (GRCm39) V158D possibly damaging Het
Parp14 A T 16: 35,655,077 (GRCm39) I1798K probably damaging Het
Pcdhga7 A G 18: 37,849,025 (GRCm39) D344G probably damaging Het
Pck1 A G 2: 172,998,770 (GRCm39) T343A probably benign Het
Pik3c2g T A 6: 139,665,873 (GRCm39) C65S probably null Het
Pilra A G 5: 137,833,674 (GRCm39) F131L probably damaging Het
Ppl A T 16: 4,906,742 (GRCm39) S1184R probably benign Het
Prmt2 C T 10: 76,058,390 (GRCm39) V140I probably damaging Het
Prpf38b A G 3: 108,818,484 (GRCm39) F92S probably damaging Het
Psmc3 A G 2: 90,884,915 (GRCm39) probably benign Het
Ptgs1 A T 2: 36,141,272 (GRCm39) N573I probably damaging Het
Rgs9 C A 11: 109,118,157 (GRCm39) A332S probably benign Het
Rptor T C 11: 119,787,305 (GRCm39) I1290T possibly damaging Het
Slc38a7 C A 8: 96,568,278 (GRCm39) R369L probably damaging Het
Slc4a2 G A 5: 24,643,760 (GRCm39) S855N probably benign Het
Slco2a1 G T 9: 102,923,925 (GRCm39) L46F probably damaging Het
Snrpd3 G T 10: 75,355,227 (GRCm39) C20F possibly damaging Het
Stab2 A T 10: 86,699,422 (GRCm39) I481N probably benign Het
Tbc1d9 A G 8: 83,960,176 (GRCm39) E143G probably damaging Het
Tenm2 T A 11: 35,959,208 (GRCm39) T1114S probably damaging Het
Tg A C 15: 66,607,101 (GRCm39) M213L probably benign Het
Tnc A G 4: 63,938,648 (GRCm39) C64R probably damaging Het
Tpd52l1 A G 10: 31,233,916 (GRCm39) L79S probably damaging Het
Tpp2 C A 1: 43,993,896 (GRCm39) S260R possibly damaging Het
Tppp2 G A 14: 52,157,912 (GRCm39) R119Q probably benign Het
Tshz2 A T 2: 169,804,493 (GRCm39) probably benign Het
Tuba8 T C 6: 121,199,862 (GRCm39) V182A probably damaging Het
Ufl1 A G 4: 25,254,780 (GRCm39) Y559H probably benign Het
Usp53 A T 3: 122,727,595 (GRCm39) S996T probably benign Het
Vcam1 A G 3: 115,918,037 (GRCm39) V308A probably damaging Het
Wdr17 T A 8: 55,143,271 (GRCm39) probably null Het
Wdr6 G A 9: 108,451,565 (GRCm39) H773Y probably damaging Het
Wnk4 T G 11: 101,152,014 (GRCm39) F173V probably damaging Het
Xrcc5 T C 1: 72,378,188 (GRCm39) Y395H probably damaging Het
Zcwpw1 T A 5: 137,793,781 (GRCm39) M1K probably null Het
Zfp263 A G 16: 3,564,704 (GRCm39) R240G possibly damaging Het
Zfp652 A G 11: 95,640,890 (GRCm39) I272V possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115,984,524 (GRCm39) missense probably damaging 0.99
IGL00482:Cit APN 5 116,076,814 (GRCm39) missense probably damaging 0.97
IGL01317:Cit APN 5 116,046,775 (GRCm39) missense probably benign 0.03
IGL01335:Cit APN 5 116,046,889 (GRCm39) splice site probably benign
IGL01415:Cit APN 5 116,079,962 (GRCm39) missense possibly damaging 0.78
IGL01447:Cit APN 5 116,011,902 (GRCm39) splice site probably benign
IGL01537:Cit APN 5 116,071,913 (GRCm39) missense probably benign 0.00
IGL01621:Cit APN 5 116,130,662 (GRCm39) splice site probably benign
IGL02010:Cit APN 5 116,014,006 (GRCm39) missense probably damaging 1.00
IGL02538:Cit APN 5 116,125,048 (GRCm39) nonsense probably null
IGL02607:Cit APN 5 115,997,268 (GRCm39) missense probably benign
IGL02720:Cit APN 5 116,133,511 (GRCm39) missense probably benign 0.26
IGL02725:Cit APN 5 116,123,532 (GRCm39) missense probably benign 0.02
IGL02967:Cit APN 5 116,083,896 (GRCm39) missense probably benign 0.11
IGL02973:Cit APN 5 116,144,058 (GRCm39) missense possibly damaging 0.73
IGL03383:Cit APN 5 116,011,904 (GRCm39) splice site probably benign
PIT4514001:Cit UTSW 5 116,135,913 (GRCm39) critical splice donor site probably null
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0226:Cit UTSW 5 116,122,899 (GRCm39) missense probably damaging 0.99
R0320:Cit UTSW 5 116,117,504 (GRCm39) missense possibly damaging 0.87
R0401:Cit UTSW 5 116,123,538 (GRCm39) missense probably benign 0.06
R0480:Cit UTSW 5 116,071,452 (GRCm39) splice site probably benign
R0609:Cit UTSW 5 116,012,002 (GRCm39) missense probably damaging 0.98
R0737:Cit UTSW 5 116,084,978 (GRCm39) missense probably damaging 1.00
R1238:Cit UTSW 5 115,989,280 (GRCm39) missense probably benign 0.30
R1503:Cit UTSW 5 116,011,959 (GRCm39) missense possibly damaging 0.94
R1551:Cit UTSW 5 116,083,901 (GRCm39) missense probably benign 0.00
R1602:Cit UTSW 5 116,135,789 (GRCm39) missense probably damaging 1.00
R1720:Cit UTSW 5 116,105,956 (GRCm39) missense probably damaging 0.98
R1854:Cit UTSW 5 116,011,960 (GRCm39) missense probably damaging 1.00
R1886:Cit UTSW 5 116,071,545 (GRCm39) missense probably damaging 1.00
R2024:Cit UTSW 5 116,143,899 (GRCm39) missense probably damaging 0.97
R2024:Cit UTSW 5 116,085,983 (GRCm39) missense probably damaging 0.97
R2048:Cit UTSW 5 116,024,872 (GRCm39) splice site probably null
R2128:Cit UTSW 5 116,123,566 (GRCm39) missense possibly damaging 0.63
R2192:Cit UTSW 5 116,106,068 (GRCm39) missense probably benign 0.00
R2244:Cit UTSW 5 116,064,564 (GRCm39) missense probably damaging 1.00
R2518:Cit UTSW 5 116,125,105 (GRCm39) missense probably damaging 0.99
R2679:Cit UTSW 5 116,107,174 (GRCm39) missense probably benign 0.00
R2898:Cit UTSW 5 116,012,037 (GRCm39) splice site probably null
R2908:Cit UTSW 5 116,119,735 (GRCm39) missense probably benign 0.00
R3079:Cit UTSW 5 116,063,545 (GRCm39) missense probably damaging 0.97
R3779:Cit UTSW 5 115,997,400 (GRCm39) missense probably benign 0.01
R4081:Cit UTSW 5 116,086,109 (GRCm39) missense probably damaging 1.00
R4494:Cit UTSW 5 116,012,043 (GRCm39) missense probably damaging 1.00
R4610:Cit UTSW 5 116,132,146 (GRCm39) missense probably benign 0.01
R4757:Cit UTSW 5 116,135,608 (GRCm39) missense probably damaging 1.00
R4788:Cit UTSW 5 116,071,565 (GRCm39) missense probably damaging 1.00
R4816:Cit UTSW 5 116,046,750 (GRCm39) missense probably damaging 1.00
R4890:Cit UTSW 5 116,126,182 (GRCm39) intron probably benign
R4899:Cit UTSW 5 116,001,087 (GRCm39) missense possibly damaging 0.60
R4928:Cit UTSW 5 116,123,856 (GRCm39) missense probably benign 0.00
R5151:Cit UTSW 5 116,117,894 (GRCm39) missense probably damaging 1.00
R5154:Cit UTSW 5 116,126,464 (GRCm39) missense probably damaging 1.00
R5222:Cit UTSW 5 116,090,602 (GRCm39) missense probably benign 0.03
R5814:Cit UTSW 5 116,117,478 (GRCm39) missense probably damaging 1.00
R5935:Cit UTSW 5 116,063,598 (GRCm39) intron probably benign
R5946:Cit UTSW 5 116,135,593 (GRCm39) missense probably damaging 1.00
R6051:Cit UTSW 5 115,984,464 (GRCm39) missense probably benign
R6289:Cit UTSW 5 116,144,385 (GRCm39) makesense probably null
R6298:Cit UTSW 5 116,086,124 (GRCm39) missense probably damaging 1.00
R6362:Cit UTSW 5 116,024,735 (GRCm39) missense probably benign 0.01
R6545:Cit UTSW 5 115,984,493 (GRCm39) missense probably null 0.00
R6761:Cit UTSW 5 116,046,734 (GRCm39) missense probably damaging 1.00
R6798:Cit UTSW 5 116,064,585 (GRCm39) missense possibly damaging 0.56
R6814:Cit UTSW 5 116,023,022 (GRCm39) missense probably damaging 1.00
R6825:Cit UTSW 5 116,119,833 (GRCm39) missense probably damaging 0.99
R6845:Cit UTSW 5 116,122,947 (GRCm39) missense probably damaging 1.00
R6983:Cit UTSW 5 116,132,150 (GRCm39) missense probably damaging 1.00
R7164:Cit UTSW 5 116,123,846 (GRCm39) missense possibly damaging 0.94
R7359:Cit UTSW 5 116,064,633 (GRCm39) missense probably damaging 1.00
R7597:Cit UTSW 5 116,024,740 (GRCm39) nonsense probably null
R7729:Cit UTSW 5 116,122,881 (GRCm39) missense possibly damaging 0.87
R7763:Cit UTSW 5 116,125,060 (GRCm39) missense probably benign 0.01
R7786:Cit UTSW 5 116,001,077 (GRCm39) missense probably benign 0.00
R7799:Cit UTSW 5 116,001,027 (GRCm39) missense probably benign 0.00
R8060:Cit UTSW 5 116,046,786 (GRCm39) missense probably benign 0.00
R8068:Cit UTSW 5 116,120,294 (GRCm39) missense probably benign 0.03
R8068:Cit UTSW 5 116,090,525 (GRCm39) missense probably damaging 1.00
R8122:Cit UTSW 5 116,107,069 (GRCm39) missense probably damaging 1.00
R8177:Cit UTSW 5 116,126,218 (GRCm39) missense probably benign 0.18
R8178:Cit UTSW 5 116,107,131 (GRCm39) missense probably damaging 1.00
R8265:Cit UTSW 5 116,126,236 (GRCm39) missense probably damaging 1.00
R8359:Cit UTSW 5 116,122,603 (GRCm39) splice site probably null
R8397:Cit UTSW 5 116,024,856 (GRCm39) missense probably benign
R8489:Cit UTSW 5 116,083,962 (GRCm39) critical splice donor site probably null
R8784:Cit UTSW 5 115,984,442 (GRCm39) nonsense probably null
R8798:Cit UTSW 5 116,107,102 (GRCm39) missense probably damaging 0.99
R8882:Cit UTSW 5 116,001,089 (GRCm39) missense probably benign 0.04
R8984:Cit UTSW 5 116,064,534 (GRCm39) missense possibly damaging 0.86
R9091:Cit UTSW 5 115,984,161 (GRCm39) intron probably benign
R9127:Cit UTSW 5 116,074,896 (GRCm39) nonsense probably null
R9204:Cit UTSW 5 116,126,498 (GRCm39) missense probably damaging 0.99
R9212:Cit UTSW 5 116,013,952 (GRCm39) missense possibly damaging 0.75
R9279:Cit UTSW 5 116,065,970 (GRCm39) missense probably damaging 1.00
R9288:Cit UTSW 5 116,123,512 (GRCm39) missense probably damaging 1.00
R9377:Cit UTSW 5 116,084,914 (GRCm39) missense probably benign 0.04
R9520:Cit UTSW 5 116,079,954 (GRCm39) nonsense probably null
Z1088:Cit UTSW 5 116,123,592 (GRCm39) missense possibly damaging 0.62
Z1176:Cit UTSW 5 116,124,662 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCCTGGTTTCCGTTGG -3'
(R):5'- AGTTAGGACTCCCACCAGAC -3'

Sequencing Primer
(F):5'- TTCCGTTGGAAAAACAGCTG -3'
(R):5'- GTTAGGACTCCCACCAGACAAAAG -3'
Posted On 2016-06-06