Incidental Mutation 'R5073:Tuba8'
ID 388972
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Name tubulin, alpha 8
Synonyms
MMRRC Submission 042662-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5073 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121187655-121203813 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121199862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
AlphaFold Q9JJZ2
Predicted Effect probably damaging
Transcript: ENSMUST00000032233
AA Change: V182A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137
AA Change: V182A

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124853
Meta Mutation Damage Score 0.6581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Adcy8 A T 15: 64,659,207 (GRCm39) W528R probably damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Ahnak T A 19: 8,980,595 (GRCm39) H626Q probably benign Het
Ampd2 A T 3: 107,986,549 (GRCm39) M245K probably damaging Het
Apob G A 12: 8,055,219 (GRCm39) probably null Het
Apool C T X: 111,259,540 (GRCm39) Q60* probably null Het
Aqp1 A T 6: 55,322,520 (GRCm39) I172F probably damaging Het
Atp7a A G X: 105,153,374 (GRCm39) D1092G probably benign Het
Bcas3 A G 11: 85,261,958 (GRCm39) Y110C probably damaging Het
Brpf1 T C 6: 113,287,215 (GRCm39) S148P probably damaging Het
Capn3 A G 2: 120,322,301 (GRCm39) H339R probably damaging Het
Ccdc141 A T 2: 76,954,722 (GRCm39) probably null Het
Ccl2 A G 11: 81,927,984 (GRCm39) probably benign Het
Cct8l1 G A 5: 25,721,881 (GRCm39) V199I probably benign Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cit T A 5: 116,084,902 (GRCm39) M811K probably benign Het
Crim1 T C 17: 78,588,776 (GRCm39) C284R possibly damaging Het
Cyp2d10 C T 15: 82,287,954 (GRCm39) R383H probably benign Het
Cyp4a29 A G 4: 115,104,860 (GRCm39) T123A probably benign Het
Dbndd2 A G 2: 164,332,224 (GRCm39) probably benign Het
Dnaja3 A T 16: 4,514,289 (GRCm39) T274S probably damaging Het
Dot1l A G 10: 80,620,480 (GRCm39) D514G possibly damaging Het
Dysf A T 6: 84,114,254 (GRCm39) K1226M probably damaging Het
Eef1akmt1 A G 14: 57,803,464 (GRCm39) L30P probably damaging Het
Elavl1 A G 8: 4,351,741 (GRCm39) M125T possibly damaging Het
Eml4 C A 17: 83,771,006 (GRCm39) S723R probably damaging Het
Fgf15 A C 7: 144,450,576 (GRCm39) Y54S possibly damaging Het
Fign A T 2: 63,810,037 (GRCm39) L411* probably null Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Fryl G A 5: 73,232,110 (GRCm39) P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gprasp2 C T X: 134,743,346 (GRCm39) T235I possibly damaging Het
H2ab3 T C X: 119,222,543 (GRCm39) T84A probably damaging Het
Hal A T 10: 93,349,904 (GRCm39) I555F probably damaging Het
Hdac6 A G X: 7,811,036 (GRCm39) F104L probably damaging Het
Hibadh C T 6: 52,597,079 (GRCm39) V122M possibly damaging Het
Hmga1b C T 11: 120,654,012 (GRCm39) Q100* probably null Het
Hydin A G 8: 111,265,105 (GRCm39) N2763D probably benign Het
Ifi47 A G 11: 48,986,361 (GRCm39) T43A probably benign Het
Ifnlr1 A G 4: 135,432,457 (GRCm39) T298A probably benign Het
Impdh2 G A 9: 108,440,535 (GRCm39) probably null Het
Insr A G 8: 3,209,475 (GRCm39) F1203L probably damaging Het
Kcnq4 A G 4: 120,574,714 (GRCm39) S117P probably damaging Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Kif1a T C 1: 92,950,227 (GRCm39) H1400R probably damaging Het
Kiss1r C A 10: 79,754,596 (GRCm39) S30* probably null Het
Krt222 T A 11: 99,134,796 (GRCm39) probably benign Het
Lekr1 A T 3: 65,727,215 (GRCm39) noncoding transcript Het
Ltn1 A G 16: 87,224,628 (GRCm39) V32A probably damaging Het
Marchf1 T A 8: 66,839,020 (GRCm39) W21R probably benign Het
Marchf5 A G 19: 37,188,207 (GRCm39) N58S possibly damaging Het
Mast4 G A 13: 102,875,391 (GRCm39) Q1158* probably null Het
Mib2 C G 4: 155,741,233 (GRCm39) A535P probably damaging Het
Mrtfa A G 15: 80,906,627 (GRCm39) V91A probably damaging Het
Msc C T 1: 14,824,537 (GRCm39) V178M probably benign Het
Muc4 C A 16: 32,754,529 (GRCm38) H1468N probably benign Het
Muc5b A T 7: 141,412,999 (GRCm39) T1982S unknown Het
Mvk A T 5: 114,591,013 (GRCm39) probably benign Het
Myo1a T C 10: 127,543,288 (GRCm39) probably null Het
Myo6 T G 9: 80,195,290 (GRCm39) S887A probably benign Het
Myo7a G A 7: 97,722,425 (GRCm39) Q1167* probably null Het
Ncald A T 15: 37,397,478 (GRCm39) H67Q probably damaging Het
Nmnat1 C A 4: 149,553,595 (GRCm39) M172I probably benign Het
Nudt1 G T 5: 140,317,662 (GRCm39) probably null Het
Nudt5 T A 2: 5,869,198 (GRCm39) H141Q probably benign Het
Or1m1 T C 9: 18,666,118 (GRCm39) E271G possibly damaging Het
Or4e1 T A 14: 52,701,032 (GRCm39) M118L probably damaging Het
Or8h10 A T 2: 86,808,666 (GRCm39) V158D possibly damaging Het
Parp14 A T 16: 35,655,077 (GRCm39) I1798K probably damaging Het
Pcdhga7 A G 18: 37,849,025 (GRCm39) D344G probably damaging Het
Pck1 A G 2: 172,998,770 (GRCm39) T343A probably benign Het
Pik3c2g T A 6: 139,665,873 (GRCm39) C65S probably null Het
Pilra A G 5: 137,833,674 (GRCm39) F131L probably damaging Het
Ppl A T 16: 4,906,742 (GRCm39) S1184R probably benign Het
Prmt2 C T 10: 76,058,390 (GRCm39) V140I probably damaging Het
Prpf38b A G 3: 108,818,484 (GRCm39) F92S probably damaging Het
Psmc3 A G 2: 90,884,915 (GRCm39) probably benign Het
Ptgs1 A T 2: 36,141,272 (GRCm39) N573I probably damaging Het
Rgs9 C A 11: 109,118,157 (GRCm39) A332S probably benign Het
Rptor T C 11: 119,787,305 (GRCm39) I1290T possibly damaging Het
Slc38a7 C A 8: 96,568,278 (GRCm39) R369L probably damaging Het
Slc4a2 G A 5: 24,643,760 (GRCm39) S855N probably benign Het
Slco2a1 G T 9: 102,923,925 (GRCm39) L46F probably damaging Het
Snrpd3 G T 10: 75,355,227 (GRCm39) C20F possibly damaging Het
Stab2 A T 10: 86,699,422 (GRCm39) I481N probably benign Het
Tbc1d9 A G 8: 83,960,176 (GRCm39) E143G probably damaging Het
Tenm2 T A 11: 35,959,208 (GRCm39) T1114S probably damaging Het
Tg A C 15: 66,607,101 (GRCm39) M213L probably benign Het
Tnc A G 4: 63,938,648 (GRCm39) C64R probably damaging Het
Tpd52l1 A G 10: 31,233,916 (GRCm39) L79S probably damaging Het
Tpp2 C A 1: 43,993,896 (GRCm39) S260R possibly damaging Het
Tppp2 G A 14: 52,157,912 (GRCm39) R119Q probably benign Het
Tshz2 A T 2: 169,804,493 (GRCm39) probably benign Het
Ufl1 A G 4: 25,254,780 (GRCm39) Y559H probably benign Het
Usp53 A T 3: 122,727,595 (GRCm39) S996T probably benign Het
Vcam1 A G 3: 115,918,037 (GRCm39) V308A probably damaging Het
Wdr17 T A 8: 55,143,271 (GRCm39) probably null Het
Wdr6 G A 9: 108,451,565 (GRCm39) H773Y probably damaging Het
Wnk4 T G 11: 101,152,014 (GRCm39) F173V probably damaging Het
Xrcc5 T C 1: 72,378,188 (GRCm39) Y395H probably damaging Het
Zcwpw1 T A 5: 137,793,781 (GRCm39) M1K probably null Het
Zfp263 A G 16: 3,564,704 (GRCm39) R240G possibly damaging Het
Zfp652 A G 11: 95,640,890 (GRCm39) I272V possibly damaging Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121,197,470 (GRCm39) missense probably benign
IGL02725:Tuba8 APN 6 121,202,916 (GRCm39) nonsense probably null
IGL03091:Tuba8 APN 6 121,197,403 (GRCm39) missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121,199,913 (GRCm39) missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121,202,863 (GRCm39) missense probably benign 0.37
R1424:Tuba8 UTSW 6 121,197,470 (GRCm39) missense probably benign
R1624:Tuba8 UTSW 6 121,197,385 (GRCm39) missense probably damaging 1.00
R1741:Tuba8 UTSW 6 121,199,727 (GRCm39) missense possibly damaging 0.95
R1985:Tuba8 UTSW 6 121,197,479 (GRCm39) missense probably benign 0.00
R2513:Tuba8 UTSW 6 121,202,932 (GRCm39) missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121,199,697 (GRCm39) missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121,199,697 (GRCm39) missense possibly damaging 0.80
R4074:Tuba8 UTSW 6 121,199,756 (GRCm39) missense probably damaging 1.00
R4875:Tuba8 UTSW 6 121,203,042 (GRCm39) utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121,197,548 (GRCm39) missense probably damaging 1.00
R5444:Tuba8 UTSW 6 121,203,060 (GRCm39) utr 3 prime probably benign
R5546:Tuba8 UTSW 6 121,199,872 (GRCm39) nonsense probably null
R5594:Tuba8 UTSW 6 121,202,863 (GRCm39) missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121,202,854 (GRCm39) missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121,199,871 (GRCm39) missense probably damaging 1.00
R7489:Tuba8 UTSW 6 121,202,980 (GRCm39) missense probably damaging 1.00
R7774:Tuba8 UTSW 6 121,200,348 (GRCm39) missense probably damaging 0.99
R8046:Tuba8 UTSW 6 121,199,832 (GRCm39) missense probably damaging 1.00
R8134:Tuba8 UTSW 6 121,198,381 (GRCm39) missense probably benign 0.00
R8284:Tuba8 UTSW 6 121,199,736 (GRCm39) missense probably damaging 1.00
R9337:Tuba8 UTSW 6 121,202,823 (GRCm39) missense probably damaging 1.00
R9562:Tuba8 UTSW 6 121,200,063 (GRCm39) missense probably benign 0.25
R9565:Tuba8 UTSW 6 121,200,063 (GRCm39) missense probably benign 0.25
Z1177:Tuba8 UTSW 6 121,200,298 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCTCTCTCCAGACTGATG -3'
(R):5'- TGAAACTCTGTGAGGTCCAC -3'

Sequencing Primer
(F):5'- AGACTGATGCCTGCTCCG -3'
(R):5'- CATTGAGGGCGCCATCAAAGC -3'
Posted On 2016-06-06