Incidental Mutation 'R5073:Myo1a'
ID388998
Institutional Source Beutler Lab
Gene Symbol Myo1a
Ensembl Gene ENSMUSG00000025401
Gene Namemyosin IA
Synonymsbrush border myosin 1, BBM-I, Myhl
MMRRC Submission 042662-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5073 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127705170-127720940 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 127707419 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079590]
Predicted Effect probably null
Transcript: ENSMUST00000079590
SMART Domains Protein: ENSMUSP00000078540
Gene: ENSMUSG00000025401

DomainStartEndE-ValueType
MYSc 3 695 N/A SMART
IQ 696 718 1.27e-3 SMART
IQ 719 741 1.09e-2 SMART
IQ 742 764 7.52e-6 SMART
Pfam:Myosin_TH1 847 1035 1.4e-42 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display abnormal small intestine brush border morphology, but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Myo1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Myo1a APN 10 127720660 missense probably benign 0.00
IGL01896:Myo1a APN 10 127719904 missense probably benign
IGL02073:Myo1a APN 10 127710225 missense probably damaging 0.98
IGL02380:Myo1a APN 10 127714485 missense probably benign 0.00
IGL02507:Myo1a APN 10 127712609 missense probably damaging 0.98
R0106:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0326:Myo1a UTSW 10 127716297 missense probably benign 0.00
R0357:Myo1a UTSW 10 127710902 missense probably benign 0.02
R0485:Myo1a UTSW 10 127719242 splice site probably benign
R0676:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0707:Myo1a UTSW 10 127719863 unclassified probably benign
R1241:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1441:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1458:Myo1a UTSW 10 127719937 missense probably benign
R1546:Myo1a UTSW 10 127712624 missense probably damaging 1.00
R1692:Myo1a UTSW 10 127719334 synonymous probably null
R1871:Myo1a UTSW 10 127719671 missense probably benign
R2067:Myo1a UTSW 10 127705478 missense probably benign 0.25
R2079:Myo1a UTSW 10 127720613 missense probably benign 0.00
R2151:Myo1a UTSW 10 127720181 missense probably benign 0.18
R2375:Myo1a UTSW 10 127705290 missense probably damaging 1.00
R3014:Myo1a UTSW 10 127716345 missense probably damaging 1.00
R3741:Myo1a UTSW 10 127714898 missense probably benign 0.19
R3812:Myo1a UTSW 10 127707415 missense possibly damaging 0.89
R4303:Myo1a UTSW 10 127713733 missense probably benign 0.10
R4306:Myo1a UTSW 10 127714081 missense probably benign
R4472:Myo1a UTSW 10 127710458 missense probably benign 0.06
R4599:Myo1a UTSW 10 127720151 unclassified probably null
R4604:Myo1a UTSW 10 127711138 missense probably damaging 1.00
R4649:Myo1a UTSW 10 127710217 missense probably benign 0.05
R4747:Myo1a UTSW 10 127714438 missense probably damaging 1.00
R4755:Myo1a UTSW 10 127715688 missense probably damaging 1.00
R4972:Myo1a UTSW 10 127716309 missense probably benign 0.31
R5072:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5074:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5386:Myo1a UTSW 10 127705897 nonsense probably null
R5592:Myo1a UTSW 10 127714039 missense probably damaging 1.00
R5619:Myo1a UTSW 10 127718544 missense probably benign 0.00
R6001:Myo1a UTSW 10 127706925 critical splice donor site probably null
R6374:Myo1a UTSW 10 127707680 missense probably damaging 1.00
R6577:Myo1a UTSW 10 127715320 missense possibly damaging 0.94
R6932:Myo1a UTSW 10 127710458 missense probably benign 0.06
R7310:Myo1a UTSW 10 127705828 missense probably damaging 0.98
R7395:Myo1a UTSW 10 127710440 missense probably damaging 0.98
R7429:Myo1a UTSW 10 127706847 missense probably damaging 1.00
R7430:Myo1a UTSW 10 127706847 missense probably damaging 1.00
X0067:Myo1a UTSW 10 127713745 missense probably damaging 1.00
Z1177:Myo1a UTSW 10 127706875 missense probably benign 0.20
Z1177:Myo1a UTSW 10 127706881 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGAGTGAACACATCTGCCC -3'
(R):5'- ATCCATCTGAAAGCCCAGGG -3'

Sequencing Primer
(F):5'- TGAACACATCTGCCCCGGAG -3'
(R):5'- ATCTGAAAGCCCAGGGGACTC -3'
Posted On2016-06-06