Incidental Mutation 'R5073:Mast4'
ID389011
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 042662-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R5073 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 102738883 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1158 (Q1158*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect probably null
Transcript: ENSMUST00000099202
AA Change: Q1149*
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: Q1149*

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167058
AA Change: Q1326*
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: Q1326*

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171791
AA Change: Q1134*
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: Q1134*

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect probably null
Transcript: ENSMUST00000194446
AA Change: Q1158*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGAGTGTCCCAACAGTG -3'
(R):5'- CTCACGGAGAGGACACAATTG -3'

Sequencing Primer
(F):5'- CCAACAGTGGGGATGGTGAAC -3'
(R):5'- ACACAATTGGGGGCCATTCTG -3'
Posted On2016-06-06