Incidental Mutation 'R5073:Ncald'
ID389017
Institutional Source Beutler Lab
Gene Symbol Ncald
Ensembl Gene ENSMUSG00000051359
Gene Nameneurocalcin delta
SynonymsD15Ertd412e, D030020D09Rik
MMRRC Submission 042662-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5073 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37366175-37792570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37397234 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 67 (H67Q)
Ref Sequence ENSEMBL: ENSMUSP00000130126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090150] [ENSMUST00000116445] [ENSMUST00000119730] [ENSMUST00000120746] [ENSMUST00000148652] [ENSMUST00000150453] [ENSMUST00000153775] [ENSMUST00000168992]
Predicted Effect probably damaging
Transcript: ENSMUST00000090150
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087611
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116445
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112146
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119730
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113858
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120746
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112898
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132423
Predicted Effect probably damaging
Transcript: ENSMUST00000148652
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121460
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
Pfam:EF-hand_5 149 163 1.2e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150453
AA Change: H67Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119726
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
Pfam:EF-hand_7 3 88 3.9e-8 PFAM
Pfam:EF-hand_8 39 88 8.2e-8 PFAM
Pfam:EF-hand_1 64 88 5e-8 PFAM
Pfam:EF-hand_6 64 88 1.6e-6 PFAM
Pfam:EF-hand_5 65 86 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153775
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114576
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 174 1.4e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168992
AA Change: H67Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130126
Gene: ENSMUSG00000051359
AA Change: H67Q

DomainStartEndE-ValueType
EFh 64 92 4.19e-4 SMART
EFh 100 128 4.7e-7 SMART
EFh 148 176 1.95e-4 SMART
Meta Mutation Damage Score 0.5044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency 100% (113/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele could not be generated. Mice heterozygous for the targeted allele exhibit increased systemic arterial systolic blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ahnak T A 19: 9,003,231 H626Q probably benign Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Bcas3 A G 11: 85,371,132 Y110C probably damaging Het
Brpf1 T C 6: 113,310,254 S148P probably damaging Het
Capn3 A G 2: 120,491,820 H339R probably damaging Het
Ccdc141 A T 2: 77,124,378 probably null Het
Ccl2 A G 11: 82,037,158 probably benign Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cit T A 5: 115,946,843 M811K probably benign Het
Crim1 T C 17: 78,281,347 C284R possibly damaging Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Cyp4a29 A G 4: 115,247,663 T123A probably benign Het
Dbndd2 A G 2: 164,490,304 probably benign Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Eef1akmt1 A G 14: 57,566,007 L30P probably damaging Het
Elavl1 A G 8: 4,301,741 M125T possibly damaging Het
Eml4 C A 17: 83,463,577 S723R probably damaging Het
Fgf15 A C 7: 144,896,839 Y54S possibly damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gprasp2 C T X: 135,842,597 T235I possibly damaging Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hdac6 A G X: 7,944,797 F104L probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hmga1b C T 11: 120,763,186 Q100* probably null Het
Hydin A G 8: 110,538,473 N2763D probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Ifnlr1 A G 4: 135,705,146 T298A probably benign Het
Impdh2 G A 9: 108,563,336 probably null Het
Insr A G 8: 3,159,475 F1203L probably damaging Het
Kcnq4 A G 4: 120,717,517 S117P probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kif1a T C 1: 93,022,505 H1400R probably damaging Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Krt222 T A 11: 99,243,970 probably benign Het
Lekr1 A T 3: 65,819,794 noncoding transcript Het
Ltn1 A G 16: 87,427,740 V32A probably damaging Het
March1 T A 8: 66,386,368 W21R probably benign Het
March5 A G 19: 37,210,808 N58S possibly damaging Het
Mast4 G A 13: 102,738,883 Q1158* probably null Het
Mib2 C G 4: 155,656,776 A535P probably damaging Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Msc C T 1: 14,754,313 V178M probably benign Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Mvk A T 5: 114,452,952 probably benign Het
Myo1a T C 10: 127,707,419 probably null Het
Myo6 T G 9: 80,288,008 S887A probably benign Het
Myo7a G A 7: 98,073,218 Q1167* probably null Het
Nmnat1 C A 4: 149,469,138 M172I probably benign Het
Nudt1 G T 5: 140,331,907 probably null Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1508 T A 14: 52,463,575 M118L probably damaging Het
Olfr24 T C 9: 18,754,822 E271G possibly damaging Het
Parp14 A T 16: 35,834,707 I1798K probably damaging Het
Pcdhga7 A G 18: 37,715,972 D344G probably damaging Het
Pck1 A G 2: 173,156,977 T343A probably benign Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prpf38b A G 3: 108,911,168 F92S probably damaging Het
Psmc3 A G 2: 91,054,570 probably benign Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rgs9 C A 11: 109,227,331 A332S probably benign Het
Rptor T C 11: 119,896,479 I1290T possibly damaging Het
Slc38a7 C A 8: 95,841,650 R369L probably damaging Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slco2a1 G T 9: 103,046,726 L46F probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tbc1d9 A G 8: 83,233,547 E143G probably damaging Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tg A C 15: 66,735,252 M213L probably benign Het
Tnc A G 4: 64,020,411 C64R probably damaging Het
Tpd52l1 A G 10: 31,357,920 L79S probably damaging Het
Tpp2 C A 1: 43,954,736 S260R possibly damaging Het
Tppp2 G A 14: 51,920,455 R119Q probably benign Het
Tshz2 A T 2: 169,962,573 probably benign Het
Tuba8 T C 6: 121,222,903 V182A probably damaging Het
Ufl1 A G 4: 25,254,780 Y559H probably benign Het
Usp53 A T 3: 122,933,946 S996T probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Wdr17 T A 8: 54,690,236 probably null Het
Wdr6 G A 9: 108,574,366 H773Y probably damaging Het
Wnk4 T G 11: 101,261,188 F173V probably damaging Het
Xrcc5 T C 1: 72,339,029 Y395H probably damaging Het
Zcwpw1 T A 5: 137,795,519 M1K probably null Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Zfp652 A G 11: 95,750,064 I272V possibly damaging Het
Other mutations in Ncald
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Ncald APN 15 37372207 missense possibly damaging 0.78
IGL02373:Ncald APN 15 37372209 missense probably benign 0.05
R0507:Ncald UTSW 15 37397284 missense probably benign 0.03
R1168:Ncald UTSW 15 37397334 missense probably damaging 0.99
R1700:Ncald UTSW 15 37397343 missense probably benign 0.04
R1914:Ncald UTSW 15 37397080 missense probably benign 0.00
R1915:Ncald UTSW 15 37397080 missense probably benign 0.00
R2057:Ncald UTSW 15 37397179 missense possibly damaging 0.93
R3873:Ncald UTSW 15 37397253 missense probably damaging 1.00
R4612:Ncald UTSW 15 37397349 missense probably benign 0.04
R5071:Ncald UTSW 15 37397234 missense probably damaging 1.00
R5074:Ncald UTSW 15 37397234 missense probably damaging 1.00
R6183:Ncald UTSW 15 37397232 missense probably damaging 1.00
R7036:Ncald UTSW 15 37368878 missense probably benign 0.00
R7334:Ncald UTSW 15 37397280 missense probably damaging 0.99
R7764:Ncald UTSW 15 37397210 missense probably damaging 1.00
R8286:Ncald UTSW 15 37397261 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGGTCCTTACCTGTACAATCTC -3'
(R):5'- AATTCTTGTTGCCAGAATGGGG -3'

Sequencing Primer
(F):5'- ACCTGTACAATCTCCAGCATTTCTG -3'
(R):5'- AAGCTGCGCCCTGAAGTC -3'
Posted On2016-06-06