Incidental Mutation 'R5018:Als2cr12'
ID389038
Institutional Source Beutler Lab
Gene Symbol Als2cr12
Ensembl Gene ENSMUSG00000047528
Gene Nameamyotrophic lateral sclerosis 2 chromosome region 12
Synonyms4933425F06Rik, 4933405P16Rik
MMRRC Submission 042609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5018 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58646903-58695989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58690950 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000139420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055313] [ENSMUST00000188772] [ENSMUST00000191252] [ENSMUST00000191565]
Predicted Effect probably benign
Transcript: ENSMUST00000055313
AA Change: V67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062497
Gene: ENSMUSG00000047528
AA Change: V67A

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185953
Predicted Effect probably benign
Transcript: ENSMUST00000188772
AA Change: V67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140780
Gene: ENSMUSG00000047528
AA Change: V67A

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188839
Predicted Effect probably benign
Transcript: ENSMUST00000191252
AA Change: V67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000191565
AA Change: V67A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139420
Gene: ENSMUSG00000047528
AA Change: V67A

DomainStartEndE-ValueType
coiled coil region 125 221 N/A INTRINSIC
coiled coil region 276 359 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamdec1 A T 14: 68,571,779 F245I probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Alx4 G T 2: 93,677,419 G353V probably damaging Het
Apol7b A G 15: 77,424,716 F61L probably benign Het
Aunip T A 4: 134,523,617 probably null Het
Bfsp1 C A 2: 143,862,882 R17L possibly damaging Het
Birc6 T A 17: 74,640,059 D2926E probably damaging Het
Dmwd A G 7: 19,078,119 D166G probably damaging Het
Dnah10 T C 5: 124,762,196 S1233P possibly damaging Het
Dnah11 G T 12: 118,130,728 N868K probably benign Het
Eea1 T C 10: 96,011,037 V393A probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fyttd1 A G 16: 32,902,417 probably null Het
Hal T C 10: 93,507,551 probably null Het
Hhat A T 1: 192,595,038 L371Q probably damaging Het
Hpse2 A G 19: 43,384,824 F122S possibly damaging Het
Kif21b A G 1: 136,172,234 I1509V probably benign Het
Klhl20 T C 1: 161,101,586 D334G probably damaging Het
Macf1 C T 4: 123,385,599 D3870N probably damaging Het
Nlrc5 C T 8: 94,525,452 A1867V probably damaging Het
Nr1h5 A G 3: 102,947,795 L330P probably damaging Het
Olfr1513 A C 14: 52,349,279 C256G possibly damaging Het
Pcdh15 T G 10: 74,643,775 S573A possibly damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Scd4 T A 19: 44,337,609 M134K probably benign Het
Sh3gl2 A G 4: 85,391,054 probably benign Het
Sin3a T A 9: 57,110,891 S865T probably benign Het
Slitrk3 G A 3: 73,050,512 T309I probably benign Het
Sspo G A 6: 48,455,700 E837K probably damaging Het
Stag1 A G 9: 100,951,619 D1095G probably benign Het
Trat1 A T 16: 48,734,805 L188* probably null Het
Ubn1 A G 16: 5,063,725 D207G probably damaging Het
Ugp2 A G 11: 21,331,052 Y219H probably damaging Het
Ugt2b1 G T 5: 86,925,962 Y179* probably null Het
Vmn2r27 T A 6: 124,224,182 D272V probably benign Het
Vmn2r3 T C 3: 64,271,353 E497G probably benign Het
Vmn2r91 G T 17: 18,136,438 C789F probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Als2cr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01521:Als2cr12 APN 1 58670394 missense probably damaging 0.98
IGL02549:Als2cr12 APN 1 58659282 missense probably benign 0.05
IGL02647:Als2cr12 APN 1 58670454 missense probably benign
IGL03098:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
PIT4504001:Als2cr12 UTSW 1 58659099 missense probably benign 0.20
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1147:Als2cr12 UTSW 1 58669463 missense probably damaging 0.99
R1959:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R1960:Als2cr12 UTSW 1 58659278 missense possibly damaging 0.92
R3815:Als2cr12 UTSW 1 58659005 missense probably damaging 0.98
R4445:Als2cr12 UTSW 1 58666921 missense possibly damaging 0.83
R4617:Als2cr12 UTSW 1 58661442 missense probably benign 0.19
R4720:Als2cr12 UTSW 1 58678348 missense possibly damaging 0.46
R4816:Als2cr12 UTSW 1 58670408 missense probably benign 0.10
R4947:Als2cr12 UTSW 1 58676539 missense probably benign 0.05
R4960:Als2cr12 UTSW 1 58667806 missense probably damaging 0.98
R4970:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5112:Als2cr12 UTSW 1 58659282 missense probably benign 0.05
R5269:Als2cr12 UTSW 1 58691760 missense possibly damaging 0.83
R5426:Als2cr12 UTSW 1 58666886 nonsense probably null
R5541:Als2cr12 UTSW 1 58658429 missense probably benign 0.03
R5845:Als2cr12 UTSW 1 58667778 missense possibly damaging 0.46
R5863:Als2cr12 UTSW 1 58691749 missense probably benign 0.06
R6364:Als2cr12 UTSW 1 58658372 missense probably damaging 0.96
R6430:Als2cr12 UTSW 1 58678289 missense probably damaging 0.98
R6527:Als2cr12 UTSW 1 58692413 start codon destroyed probably null 0.01
R6573:Als2cr12 UTSW 1 58666844 missense probably benign 0.27
R7367:Als2cr12 UTSW 1 58666864 missense probably benign 0.07
R7459:Als2cr12 UTSW 1 58691752 missense possibly damaging 0.46
R7497:Als2cr12 UTSW 1 58678308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGGCCACATAGCAGCC -3'
(R):5'- ATTTGCCCTGAGAGCTCCAG -3'

Sequencing Primer
(F):5'- TAGCAGCCACCTCAAATGC -3'
(R):5'- TGAGAGCTCCAGACTGCAC -3'
Posted On2016-06-06