Mutagenetix > Incidental Mutations

Incidental Mutation 'R0433:Il21'

38904

Institutional Source

Beutler Lab

Gene Symbol

Il21

Ensembl Gene

ENSMUSG00000027718

Gene Name

interleukin 21

Synonyms

MMRRC Submission

038635-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37222759-37232636 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 37232535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 11 (I11L)

Ref Sequence

ENSEMBL: ENSMUSP00000124668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029273] [ENSMUST00000161015]

AlphaFold

Q9ES17

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029273
AA Change: I11L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029273
Gene: ENSMUSG00000027718
AA Change: I11L

Domain	Start	End	E-Value	Type
Pfam:IL15	4	142	7.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147691

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161015
AA Change: I11L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124668
Gene: ENSMUSG00000027718
AA Change: I11L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	26	38	N/A	INTRINSIC
PDB:3TGX\|P	39	140	8e-36	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200285

Meta Mutation Damage Score

0.0602

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

99% (108/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the common-gamma chain family of cytokines with immunoregulatory activity. The encoded protein plays a role in both the innate and adaptive immune responses by inducing the differentiation, proliferation and activity of multiple target cells including macrophages, natural killer cells, B cells and cytotoxic T cells. Dysregulation of this gene plays a role in multiple immune-mediated diseases including lupus, psoriasis and chronic inflammatory diseases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene develop normally and have a normal life span. One allele exhibits enhanced IgE isotype switch and IgE production after antigen immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	T	C	3: 68,870,303	V199A	possibly damaging	Het
2410089E03Rik	T	C	15: 8,216,562	S1473P	probably benign	Het
Abcb5	T	C	12: 118,877,810	M967V	probably benign	Het
Adcy10	T	A	1: 165,552,022	L951Q	probably damaging	Het
Amer2	A	T	14: 60,378,583	S76C	probably damaging	Het
Atad1	T	C	19: 32,698,477	I182M	probably benign	Het
Bpi	A	G	2: 158,258,419	D42G	probably damaging	Het
C7	G	T	15: 4,988,916	T815K	probably damaging	Het
Cacna1g	T	A	11: 94,459,207	D604V	probably benign	Het
Camk1g	A	G	1: 193,354,058	F165L	probably damaging	Het
Ccdc69	C	T	11: 55,052,890		probably null	Het
Ccser2	A	C	14: 36,918,529	F37L	probably damaging	Het
Cfap43	A	G	19: 47,825,771	F208S	probably benign	Het
Cfap54	G	A	10: 92,979,080		probably benign	Het
Cfap69	A	C	5: 5,649,853	D62E	probably damaging	Het
Cnksr2	C	A	X: 157,888,557	M483I	probably benign	Het
Cnksr2	A	T	X: 157,888,558	M483K	probably benign	Het
Cog8	T	C	8: 107,056,478	S60G	possibly damaging	Het
Col4a3	C	T	1: 82,670,219	P484S	unknown	Het
Col6a4	C	T	9: 106,067,994	G974R	probably damaging	Het
Dbnl	T	G	11: 5,796,825		probably null	Het
Dhcr7	T	C	7: 143,840,463	C114R	possibly damaging	Het
Dnah2	C	A	11: 69,459,288	D2340Y	probably damaging	Het
Dusp10	T	A	1: 184,069,196	Y387N	probably damaging	Het
Eipr1	C	T	12: 28,859,331	T199I	possibly damaging	Het
Emc2	T	G	15: 43,497,124		probably null	Het
Enpp3	A	G	10: 24,820,597	S147P	probably benign	Het
Fam133b	T	A	5: 3,558,560		probably benign	Het
Fam205c	A	G	4: 42,874,013		probably benign	Het
Fat1	C	A	8: 45,024,649	T2244K	possibly damaging	Het
Fbn1	A	G	2: 125,348,215	S1453P	possibly damaging	Het
Fez2	A	T	17: 78,418,047	F13I	probably damaging	Het
Ggnbp2	T	C	11: 84,836,420	K530R	probably damaging	Het
Gm597	A	T	1: 28,777,342	Y536*	probably null	Het
Gpa33	T	C	1: 166,163,761		probably benign	Het
Gpr142	T	C	11: 114,805,997	I123T	probably damaging	Het
Klhl7	A	G	5: 24,127,702	E86G	probably damaging	Het
Klk10	G	T	7: 43,781,565	A11S	possibly damaging	Het
Knl1	A	T	2: 119,104,061	D2115V	probably damaging	Het
Lonp2	A	G	8: 86,633,954	D185G	probably damaging	Het
Lrrc47	T	C	4: 154,018,365		probably benign	Het
Lrrcc1	A	G	3: 14,559,374	I698V	probably damaging	Het
Lzts2	T	C	19: 45,021,676	V83A	possibly damaging	Het
Melk	C	A	4: 44,340,614		probably benign	Het
Mical1	G	A	10: 41,479,490	V150I	probably benign	Het
Morn3	C	A	5: 123,039,333	M129I	probably benign	Het
Mroh2b	T	A	15: 4,941,634	D1040E	probably benign	Het
Mroh5	T	C	15: 73,790,028	N438S	probably benign	Het
Mroh5	T	A	15: 73,790,808	Q387L	probably damaging	Het
Myh15	A	G	16: 49,145,236	D1168G	probably damaging	Het
Nek10	A	G	14: 14,860,927	E493G	probably benign	Het
Nipsnap3a	A	G	4: 53,000,316	Y227C	probably damaging	Het
Nlrp9c	T	A	7: 26,385,819	T112S	probably benign	Het
Nphp4	T	C	4: 152,518,172	V401A	probably benign	Het
Nr1h2	A	G	7: 44,549,987	*365Q	probably null	Het
Olfr1339	T	C	4: 118,735,090	V187A	probably benign	Het
Olfr474	T	C	7: 107,955,262	I207T	probably damaging	Het
Pacs2	T	A	12: 113,056,844	V279D	possibly damaging	Het
Pdcd2	C	T	17: 15,526,384	C171Y	probably benign	Het
Pde11a	T	A	2: 76,337,706	D301V	possibly damaging	Het
Pfpl	T	G	19: 12,429,475	N363K	probably damaging	Het
Phf14	T	A	6: 11,933,743	S201R	probably damaging	Het
Pip4k2c	G	A	10: 127,208,946	P66S	probably benign	Het
Pou2f3	G	T	9: 43,127,398	H392N	probably benign	Het
Pou3f1	G	T	4: 124,658,904	G400C	probably damaging	Het
Ptprg	T	C	14: 12,220,620	I1219T	probably damaging	Het
Rfx6	A	G	10: 51,720,028	D435G	probably damaging	Het
Rhpn2	T	A	7: 35,385,474	S598T	probably benign	Het
Sdccag8	C	A	1: 176,844,821		probably null	Het
Sec16b	C	A	1: 157,534,709	Y43*	probably null	Het
Sele	T	C	1: 164,049,244	Y30H	possibly damaging	Het
Sgsm2	C	T	11: 74,858,190		probably null	Het
Slc45a2	T	C	15: 11,025,745	Y394H	probably benign	Het
Slc4a10	T	G	2: 62,289,983	I788S	probably benign	Het
Slmap	A	T	14: 26,453,594	L161*	probably null	Het
Slx4	A	T	16: 3,986,018	D977E	probably benign	Het
Spen	A	T	4: 141,483,758	M608K	unknown	Het
St8sia4	G	C	1: 95,591,704	T353R	probably damaging	Het
Stab2	G	T	10: 86,843,491		probably benign	Het
Stx12	C	T	4: 132,858,430	G213D	probably damaging	Het
Synj2	A	T	17: 6,033,848	N270Y	probably damaging	Het
Tdrd9	C	T	12: 112,025,581	R438*	probably null	Het
Tert	T	C	13: 73,627,081	Y18H	probably damaging	Het
Tph1	A	T	7: 46,653,821	F244L	probably damaging	Het
Triobp	T	C	15: 78,968,201	F852L	possibly damaging	Het
Trpv1	T	C	11: 73,253,008		probably benign	Het
Uggt2	A	T	14: 119,075,329		probably null	Het
Ulk4	A	G	9: 121,044,819	I1182T	probably benign	Het
Uqcc1	A	G	2: 155,910,368	Y98H	probably damaging	Het
Usp25	A	G	16: 77,109,217	I854V	probably benign	Het
Usp50	T	C	2: 126,761,544	S361G	probably damaging	Het
Uspl1	C	A	5: 149,214,815	Q743K	probably damaging	Het
Vmn2r3	A	G	3: 64,275,633	V215A	possibly damaging	Het
Vmn2r61	A	T	7: 42,265,911	H94L	probably benign	Het
Vps37c	T	C	19: 10,713,029	V285A	probably benign	Het
Vwa8	T	C	14: 79,062,676	V983A	probably damaging	Het
Wdr78	T	C	4: 103,103,253	N67D	probably benign	Het
Zcchc9	C	T	13: 91,805,962	R58H	probably benign	Het
Zdbf2	T	C	1: 63,306,143	V1227A	possibly damaging	Het
Zfp292	T	C	4: 34,839,959	K64E	probably damaging	Het
Zfp948	A	G	17: 21,587,502	T319A	probably benign	Het
Zp3r	T	G	1: 130,577,133		probably benign	Het

Other mutations in Il21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0579:Il21	UTSW	3	37227774	missense	possibly damaging	0.65
R1641:Il21	UTSW	3	37232532	missense	probably benign	0.00
R1741:Il21	UTSW	3	37227662	missense	probably benign	0.00
R1754:Il21	UTSW	3	37225525	missense	possibly damaging	0.93
R1933:Il21	UTSW	3	37232486	missense	probably benign
R4560:Il21	UTSW	3	37225484	nonsense	probably null
R4975:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4977:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R4979:Il21	UTSW	3	37232504	missense	probably damaging	0.99
R5254:Il21	UTSW	3	37227735	missense	possibly damaging	0.94
R5267:Il21	UTSW	3	37227797	missense	probably benign
R5641:Il21	UTSW	3	37227768	nonsense	probably null
R7058:Il21	UTSW	3	37232480	missense	probably damaging	1.00
R7259:Il21	UTSW	3	37227654	critical splice donor site	probably null
R9039:Il21	UTSW	3	37232453	missense	probably benign
R9249:Il21	UTSW	3	37225528	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTTGGTGATACAAGTCAAAAGGCTCC -3'
(R):5'- CTTCTCTGAAATCTGACGGTGCCTC -3'

Sequencing Primer
(F):5'- GTGACAAACATGGCCTTACCA -3'
(R):5'- Ccacacacacacacacacac -3'

Posted On

2013-05-23