Incidental Mutation 'R5019:Miga1'
ID389082
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Namemitoguardin 1
SynonymsC030011O14Rik
MMRRC Submission 042610-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5019 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location152273849-152340407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 152322461 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 144 (S144A)
Ref Sequence ENSEMBL: ENSMUSP00000143238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000196265] [ENSMUST00000199334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068243
AA Change: S144A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: S144A

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000073089
AA Change: S144A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: S144A

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196265
SMART Domains Protein: ENSMUSP00000142667
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 26 146 1.5e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199334
AA Change: S144A

PolyPhen 2 Score 0.857 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942
AA Change: S144A

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199443
Meta Mutation Damage Score 0.4791 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,165,934 W20L probably benign Het
Adamts17 T A 7: 67,062,070 Y81* probably null Het
Add3 A G 19: 53,242,571 E559G probably damaging Het
Ahcyl2 A T 6: 29,859,739 K6M possibly damaging Het
Asb3 A T 11: 31,081,415 N345I possibly damaging Het
Carm1 T C 9: 21,579,511 probably null Het
Fam155a A G 8: 9,770,240 V260A probably benign Het
Gm7257 C A 9: 36,431,902 Q7K probably benign Het
Ip6k2 T A 9: 108,797,746 probably benign Het
Kdm4c T C 4: 74,343,535 L649P probably damaging Het
Klra5 T C 6: 129,899,389 T152A probably benign Het
Mars2 T C 1: 55,237,309 S24P possibly damaging Het
Mfap2 A T 4: 141,015,258 T142S probably damaging Het
Olfr167 A T 16: 19,515,535 F34I probably damaging Het
Olfr462 A G 11: 87,888,975 V307A probably benign Het
Pcdhgb6 A G 18: 37,742,941 D234G probably damaging Het
Pclo A G 5: 14,714,367 N4285D unknown Het
Pex1 T C 5: 3,622,331 S725P probably damaging Het
Pigg A G 5: 108,332,149 Y430C probably damaging Het
Plcb2 A T 2: 118,712,136 L818Q probably benign Het
Psmd5 A G 2: 34,865,953 probably benign Het
Skint8 T C 4: 111,928,648 V97A probably damaging Het
Tfap2b T C 1: 19,226,442 V185A probably benign Het
Trim27 T C 13: 21,189,964 F294L probably damaging Het
Trp53bp1 A T 2: 121,270,319 probably null Het
Ttc28 T A 5: 111,102,064 H293Q possibly damaging Het
Xkr5 T C 8: 18,942,110 T88A probably benign Het
Xkr6 T G 14: 63,819,066 I142S unknown Het
Zfp618 T C 4: 63,103,552 Y252H probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp809 A G 9: 22,237,702 D84G probably benign Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCAAGTTCTTTGTGCTAAGC -3'
(R):5'- CAGATTTGGCATGGACTTCAGG -3'

Sequencing Primer
(F):5'- AGGTGTGGTCACAGGAAT -3'
(R):5'- TAGCATGCCTGAAACTCTGG -3'
Posted On2016-06-06