Incidental Mutation 'R5019:Olfr167'
ID 389106
Institutional Source Beutler Lab
Gene Symbol Olfr167
Ensembl Gene ENSMUSG00000045341
Gene Name olfactory receptor 167
Synonyms MOR272-1, GA_x54KRFPKG5P-15963726-15962788
MMRRC Submission 042610-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R5019 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 19509558-19522266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19515535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 34 (F34I)
Ref Sequence ENSEMBL: ENSMUSP00000150102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054606] [ENSMUST00000214315]
AlphaFold Q8VGJ5
Predicted Effect probably damaging
Transcript: ENSMUST00000054606
AA Change: F34I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055344
Gene: ENSMUSG00000045341
AA Change: F34I

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 4.8e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 295 1.2e-6 PFAM
Pfam:7tm_1 40 289 1.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214315
AA Change: F34I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217566
Meta Mutation Damage Score 0.5103 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,165,934 W20L probably benign Het
Adamts17 T A 7: 67,062,070 Y81* probably null Het
Add3 A G 19: 53,242,571 E559G probably damaging Het
Ahcyl2 A T 6: 29,859,739 K6M possibly damaging Het
Asb3 A T 11: 31,081,415 N345I possibly damaging Het
Carm1 T C 9: 21,579,511 probably null Het
Fam155a A G 8: 9,770,240 V260A probably benign Het
Gm7257 C A 9: 36,431,902 Q7K probably benign Het
Ip6k2 T A 9: 108,797,746 probably benign Het
Kdm4c T C 4: 74,343,535 L649P probably damaging Het
Klra5 T C 6: 129,899,389 T152A probably benign Het
Mars2 T C 1: 55,237,309 S24P possibly damaging Het
Mfap2 A T 4: 141,015,258 T142S probably damaging Het
Miga1 A C 3: 152,322,461 S144A possibly damaging Het
Olfr462 A G 11: 87,888,975 V307A probably benign Het
Pcdhgb6 A G 18: 37,742,941 D234G probably damaging Het
Pclo A G 5: 14,714,367 N4285D unknown Het
Pex1 T C 5: 3,622,331 S725P probably damaging Het
Pigg A G 5: 108,332,149 Y430C probably damaging Het
Plcb2 A T 2: 118,712,136 L818Q probably benign Het
Psmd5 A G 2: 34,865,953 probably benign Het
Skint8 T C 4: 111,928,648 V97A probably damaging Het
Tfap2b T C 1: 19,226,442 V185A probably benign Het
Trim27 T C 13: 21,189,964 F294L probably damaging Het
Trp53bp1 A T 2: 121,270,319 probably null Het
Ttc28 T A 5: 111,102,064 H293Q possibly damaging Het
Xkr5 T C 8: 18,942,110 T88A probably benign Het
Xkr6 T G 14: 63,819,066 I142S unknown Het
Zfp618 T C 4: 63,103,552 Y252H probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp809 A G 9: 22,237,702 D84G probably benign Het
Other mutations in Olfr167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Olfr167 APN 16 19515478 missense probably benign 0.01
IGL02115:Olfr167 APN 16 19515103 missense probably damaging 1.00
IGL02562:Olfr167 APN 16 19514964 missense possibly damaging 0.74
BB008:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
BB018:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R0366:Olfr167 UTSW 16 19514848 missense probably benign 0.13
R0673:Olfr167 UTSW 16 19515396 missense probably damaging 1.00
R1187:Olfr167 UTSW 16 19515046 missense probably benign 0.01
R1237:Olfr167 UTSW 16 19515625 missense probably benign 0.01
R1975:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1977:Olfr167 UTSW 16 19514836 missense probably damaging 0.99
R1997:Olfr167 UTSW 16 19515042 missense probably damaging 1.00
R2225:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R2226:Olfr167 UTSW 16 19515246 missense probably benign 0.05
R4078:Olfr167 UTSW 16 19515232 missense possibly damaging 0.76
R5071:Olfr167 UTSW 16 19515027 missense probably benign 0.00
R5278:Olfr167 UTSW 16 19515378 nonsense probably null
R5415:Olfr167 UTSW 16 19515246 missense possibly damaging 0.94
R5744:Olfr167 UTSW 16 19515336 missense probably benign 0.00
R5991:Olfr167 UTSW 16 19514757 missense probably damaging 0.99
R6151:Olfr167 UTSW 16 19515531 missense probably damaging 1.00
R6540:Olfr167 UTSW 16 19514821 missense probably benign
R7014:Olfr167 UTSW 16 19515456 missense probably benign 0.20
R7145:Olfr167 UTSW 16 19514899 missense probably damaging 0.99
R7535:Olfr167 UTSW 16 19514794 missense probably damaging 1.00
R7677:Olfr167 UTSW 16 19514928 missense probably benign 0.42
R7715:Olfr167 UTSW 16 19514730 missense probably benign 0.00
R7931:Olfr167 UTSW 16 19515508 missense possibly damaging 0.94
R8137:Olfr167 UTSW 16 19515096 missense possibly damaging 0.89
R8671:Olfr167 UTSW 16 19515054 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAACAAAAGGGTTTCTGCACC -3'
(R):5'- GCAGTTATGATTATTCTCAGTCTGG -3'

Sequencing Primer
(F):5'- GGTTTCTGCACCCCCAAAAGTC -3'
(R):5'- CTCAGTCTGGTGAAAATCATGAATTG -3'
Posted On 2016-06-06