Incidental Mutation 'R5019:Add3'
ID389108
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Nameadducin 3 (gamma)
Synonyms
MMRRC Submission 042610-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5019 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53140445-53247399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53242571 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 559 (E559G)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
Predicted Effect probably damaging
Transcript: ENSMUST00000025999
AA Change: E559G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: E559G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050096
AA Change: E559G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: E559G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111741
AA Change: E559G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: E559G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Meta Mutation Damage Score 0.3315 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,165,934 W20L probably benign Het
Adamts17 T A 7: 67,062,070 Y81* probably null Het
Ahcyl2 A T 6: 29,859,739 K6M possibly damaging Het
Asb3 A T 11: 31,081,415 N345I possibly damaging Het
Carm1 T C 9: 21,579,511 probably null Het
Fam155a A G 8: 9,770,240 V260A probably benign Het
Gm7257 C A 9: 36,431,902 Q7K probably benign Het
Ip6k2 T A 9: 108,797,746 probably benign Het
Kdm4c T C 4: 74,343,535 L649P probably damaging Het
Klra5 T C 6: 129,899,389 T152A probably benign Het
Mars2 T C 1: 55,237,309 S24P possibly damaging Het
Mfap2 A T 4: 141,015,258 T142S probably damaging Het
Miga1 A C 3: 152,322,461 S144A possibly damaging Het
Olfr167 A T 16: 19,515,535 F34I probably damaging Het
Olfr462 A G 11: 87,888,975 V307A probably benign Het
Pcdhgb6 A G 18: 37,742,941 D234G probably damaging Het
Pclo A G 5: 14,714,367 N4285D unknown Het
Pex1 T C 5: 3,622,331 S725P probably damaging Het
Pigg A G 5: 108,332,149 Y430C probably damaging Het
Plcb2 A T 2: 118,712,136 L818Q probably benign Het
Psmd5 A G 2: 34,865,953 probably benign Het
Skint8 T C 4: 111,928,648 V97A probably damaging Het
Tfap2b T C 1: 19,226,442 V185A probably benign Het
Trim27 T C 13: 21,189,964 F294L probably damaging Het
Trp53bp1 A T 2: 121,270,319 probably null Het
Ttc28 T A 5: 111,102,064 H293Q possibly damaging Het
Xkr5 T C 8: 18,942,110 T88A probably benign Het
Xkr6 T G 14: 63,819,066 I142S unknown Het
Zfp618 T C 4: 63,103,552 Y252H probably damaging Het
Zfp790 C T 7: 29,829,767 H626Y probably benign Het
Zfp809 A G 9: 22,237,702 D84G probably benign Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53239430 missense probably damaging 1.00
IGL02177:Add3 APN 19 53216892 nonsense probably null
IGL03093:Add3 APN 19 53231207 missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53242591 missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53236690 missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53216867 missense unknown
R0087:Add3 UTSW 19 53226607 missense probably damaging 1.00
R0335:Add3 UTSW 19 53236828 missense probably benign 0.00
R0346:Add3 UTSW 19 53216956 nonsense probably null
R0514:Add3 UTSW 19 53236843 nonsense probably null
R0692:Add3 UTSW 19 53216952 missense probably damaging 1.00
R1437:Add3 UTSW 19 53233678 missense probably damaging 0.98
R1747:Add3 UTSW 19 53242550 missense probably benign 0.41
R2926:Add3 UTSW 19 53226822 splice site probably null
R4192:Add3 UTSW 19 53242524 missense probably benign 0.00
R4780:Add3 UTSW 19 53234792 missense possibly damaging 0.64
R5486:Add3 UTSW 19 53244387 missense probably benign 0.00
R5526:Add3 UTSW 19 53226607 missense probably damaging 1.00
R5580:Add3 UTSW 19 53245211 missense probably damaging 1.00
R5851:Add3 UTSW 19 53236774 missense probably damaging 1.00
R5863:Add3 UTSW 19 53233870 missense probably benign 0.00
R5951:Add3 UTSW 19 53244289 splice site probably null
R6229:Add3 UTSW 19 53234846 missense probably benign 0.35
R7017:Add3 UTSW 19 53233853 missense possibly damaging 0.94
R7190:Add3 UTSW 19 53216899 nonsense probably null
R7222:Add3 UTSW 19 53216846 missense unknown
R7231:Add3 UTSW 19 53233146 missense probably benign 0.00
R7532:Add3 UTSW 19 53232158 missense probably damaging 1.00
R7557:Add3 UTSW 19 53239437 missense probably damaging 0.98
R7726:Add3 UTSW 19 53239461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGTTGGGTAATCACAAACG -3'
(R):5'- AGTGGTTCTCTATGGAAAGGTC -3'

Sequencing Primer
(F):5'- ATGCTTGTGCCTACGTGTGC -3'
(R):5'- TTCTCTATGGAAAGGTCTAGAGCAG -3'
Posted On2016-06-06