Incidental Mutation 'R5020:Olfr414'
List |< first << previous [record 38 of 64] next >> last >|
ID389113
Institutional Source Beutler Lab
Gene Symbol Olfr414
Ensembl Gene ENSMUSG00000051509
Gene Nameolfactory receptor 414
SynonymsGA_x6K02T2P20D-20749615-20748662, MOR103-10
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174424064-174434747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 174430671 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 81 (L81R)
Ref Sequence ENSEMBL: ENSMUSP00000142051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053178] [ENSMUST00000192358]
Predicted Effect probably damaging
Transcript: ENSMUST00000053178
AA Change: L81R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052426
Gene: ENSMUSG00000051509
AA Change: L81R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-53 PFAM
Pfam:7tm_1 41 290 8.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192358
AA Change: L81R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142051
Gene: ENSMUSG00000051509
AA Change: L81R

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.9e-29 PFAM
Pfam:7tm_4 139 283 1.1e-45 PFAM
Meta Mutation Damage Score 0.6201 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Olfr414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Olfr414 APN 1 174431342 missense probably benign 0.00
IGL01560:Olfr414 APN 1 174430901 missense probably benign 0.17
IGL01795:Olfr414 APN 1 174430649 missense possibly damaging 0.83
IGL03286:Olfr414 APN 1 174431177 missense probably benign 0.01
PIT4131001:Olfr414 UTSW 1 174430824 missense probably damaging 1.00
R0219:Olfr414 UTSW 1 174430466 missense probably benign 0.00
R0492:Olfr414 UTSW 1 174430563 missense possibly damaging 0.95
R1052:Olfr414 UTSW 1 174431135 nonsense probably null
R1054:Olfr414 UTSW 1 174430853 missense probably benign 0.36
R1473:Olfr414 UTSW 1 174430643 missense probably damaging 0.97
R1675:Olfr414 UTSW 1 174431097 missense probably benign
R1774:Olfr414 UTSW 1 174431339 missense probably benign 0.00
R1861:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R1959:Olfr414 UTSW 1 174430905 missense probably damaging 1.00
R1978:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R4043:Olfr414 UTSW 1 174431091 missense probably damaging 1.00
R5354:Olfr414 UTSW 1 174430686 missense probably damaging 0.98
R5873:Olfr414 UTSW 1 174430782 missense possibly damaging 0.84
R6053:Olfr414 UTSW 1 174430569 nonsense probably null
R8300:Olfr414 UTSW 1 174430534 nonsense probably null
Z1176:Olfr414 UTSW 1 174430591 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CACCATGAGAAATCTGAGCGG -3'
(R):5'- TCTGGGAGGCATGAGACTAG -3'

Sequencing Primer
(F):5'- AGCCACGTGGAGGAGTTTGTC -3'
(R):5'- CTAGGGTAACGAAGGGGTTCAC -3'
Posted On2016-06-06