Incidental Mutation 'R5020:Itih5'
ID 389114
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 042611-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R5020 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 10245315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably null
Transcript: ENSMUST00000026886
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A T 7: 131,042,929 (GRCm39) probably null Het
Actl6a A G 3: 32,774,656 (GRCm39) I340V possibly damaging Het
Alppl2 C T 1: 87,017,431 (GRCm39) V19I probably benign Het
Ankrd34c T C 9: 89,611,759 (GRCm39) K194R probably benign Het
Anpep T A 7: 79,483,475 (GRCm39) M672L probably benign Het
Arhgap31 T C 16: 38,423,438 (GRCm39) D876G probably damaging Het
Arid2 T A 15: 96,269,869 (GRCm39) N1327K probably damaging Het
Atp5f1d C A 10: 79,981,263 (GRCm39) P101Q probably benign Het
Bcl7b G A 5: 135,200,017 (GRCm39) probably null Het
Brca2 A T 5: 150,483,901 (GRCm39) S2907C probably damaging Het
Ccser2 T C 14: 36,662,134 (GRCm39) E350G probably benign Het
Cdh23 G T 10: 60,143,811 (GRCm39) D2929E probably damaging Het
Clec2i T A 6: 128,870,621 (GRCm39) V78E probably benign Het
Cpxm1 A T 2: 130,237,897 (GRCm39) probably null Het
Crybg3 C T 16: 59,375,159 (GRCm39) V2032I possibly damaging Het
Eif5b A T 1: 38,058,150 (GRCm39) K151* probably null Het
Gemin7 T A 7: 19,299,348 (GRCm39) E82D possibly damaging Het
Gm14496 A G 2: 181,633,152 (GRCm39) E45G possibly damaging Het
Gm21915 T C 9: 40,581,966 (GRCm39) S20P probably damaging Het
Gm8126 A C 14: 43,119,026 (GRCm39) E165A probably damaging Het
Grin2b T C 6: 135,710,405 (GRCm39) D1047G probably benign Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Ikbke T A 1: 131,201,397 (GRCm39) Y150F probably damaging Het
Inhca T C 9: 103,159,701 (GRCm39) D70G probably benign Het
Lrig2 T C 3: 104,365,217 (GRCm39) Q645R possibly damaging Het
Map4 A G 9: 109,897,868 (GRCm39) M712V probably benign Het
Mecom A G 3: 30,015,255 (GRCm39) S823P probably damaging Het
Mettl25 A G 10: 105,662,068 (GRCm39) Y301H possibly damaging Het
Mga A T 2: 119,781,654 (GRCm39) K2136* probably null Het
Mmp24 A G 2: 155,652,204 (GRCm39) E304G probably benign Het
Mmp3 T A 9: 7,445,984 (GRCm39) D29E probably benign Het
Nbas T A 12: 13,424,713 (GRCm39) I984N probably damaging Het
Nedd9 A G 13: 41,469,270 (GRCm39) Y628H probably damaging Het
Nlrp2 C T 7: 5,331,076 (GRCm39) C440Y probably damaging Het
Or4g16 T C 2: 111,136,637 (GRCm39) V29A probably benign Het
Or6p1 T G 1: 174,258,237 (GRCm39) L81R probably damaging Het
P4ha2 T C 11: 54,022,016 (GRCm39) V513A probably damaging Het
Pcsk4 T C 10: 80,161,869 (GRCm39) N124S probably benign Het
Phf12 T C 11: 77,914,622 (GRCm39) F139S probably damaging Het
Phlpp2 T A 8: 110,666,714 (GRCm39) L1081H probably damaging Het
Phospho2 T A 2: 69,626,323 (GRCm39) F160I probably damaging Het
Plch2 T G 4: 155,091,540 (GRCm39) D115A probably damaging Het
Plekho1 A G 3: 95,896,851 (GRCm39) F215S probably damaging Het
Psma4 C A 9: 54,860,056 (GRCm39) A47E probably damaging Het
Rasa4 A C 5: 136,130,153 (GRCm39) Q303P probably damaging Het
Rbmxl2 C T 7: 106,809,414 (GRCm39) P233L probably damaging Het
Reln A T 5: 22,239,636 (GRCm39) L877H probably damaging Het
Rtel1 A G 2: 180,964,307 (GRCm39) probably null Het
Septin12 T C 16: 4,811,620 (GRCm39) D116G probably damaging Het
Son T A 16: 91,453,263 (GRCm39) V670E probably damaging Het
Spag9 T A 11: 93,988,612 (GRCm39) I544N probably benign Het
Spsb3 T G 17: 25,106,036 (GRCm39) probably benign Het
Tcstv2c T C 13: 120,616,652 (GRCm39) F164L possibly damaging Het
Tgfbr3 T C 5: 107,362,836 (GRCm39) T59A probably damaging Het
Tsc1 T A 2: 28,566,531 (GRCm39) I649K probably damaging Het
Txndc9 T C 1: 38,034,793 (GRCm39) D37G probably benign Het
Uba7 C T 9: 107,856,113 (GRCm39) A496V probably benign Het
Usf3 T A 16: 44,035,889 (GRCm39) I123N probably damaging Het
Vmn1r184 T A 7: 25,966,955 (GRCm39) S234T possibly damaging Het
Vsig10l C A 7: 43,114,741 (GRCm39) S314* probably null Het
Wdfy4 A G 14: 32,801,892 (GRCm39) F1922S probably damaging Het
Zfp219 C T 14: 52,247,112 (GRCm39) R5H probably damaging Het
Zfp946 G T 17: 22,674,584 (GRCm39) C446F probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4670:Itih5 UTSW 2 10,195,180 (GRCm39) missense probably benign 0.01
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TAAGGAGGCTGCTGTCTTCC -3'
(R):5'- TGACCTCCACATGCAGTTGATC -3'

Sequencing Primer
(F):5'- TTCCTCTGCAGACCTGGAAGAC -3'
(R):5'- GTTGATCAAACTTCTTGTCCACC -3'
Posted On 2016-06-06