Incidental Mutation 'R5020:Tsc1'
List |< first << previous [record 56 of 64] next >> last >|
ID389115
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Nametuberous sclerosis 1
Synonymshamartin
MMRRC Submission 042611-MU
Accession Numbers

Ncbi RefSeq: NM_022887.3; MGI: 1929183

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28641228-28691167 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28676519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 649 (I649K)
Ref Sequence ENSEMBL: ENSMUSP00000109501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565] [ENSMUST00000156857]
Predicted Effect probably damaging
Transcript: ENSMUST00000028155
AA Change: I649K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812
AA Change: I649K

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113867
AA Change: I649K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812
AA Change: I649K

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113869
AA Change: I650K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812
AA Change: I650K

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113870
AA Change: I649K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812
AA Change: I649K

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125715
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153625
Predicted Effect probably benign
Transcript: ENSMUST00000156857
SMART Domains Protein: ENSMUSP00000115380
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 348 2.3e-170 PFAM
Meta Mutation Damage Score 0.8457 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype Strain: 2183900
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28661611 missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28672466 missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28670940 nonsense probably null
IGL01808:Tsc1 APN 2 28662507 missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28663595 missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28681258 missense probably damaging 1.00
Cassava UTSW 2 28671886 splice site probably null
R0077:Tsc1 UTSW 2 28678943 splice site probably benign
R0149:Tsc1 UTSW 2 28670901 missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28671778 missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28670930 missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28665626 missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28676026 missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R1807:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R2014:Tsc1 UTSW 2 28665637 splice site probably benign
R2284:Tsc1 UTSW 2 28665097 missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28687142 missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28670925 missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28672407 missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28679081 missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28661690 splice site probably null
R4906:Tsc1 UTSW 2 28675189 missense possibly damaging 0.81
R5401:Tsc1 UTSW 2 28686908 nonsense probably null
R5708:Tsc1 UTSW 2 28665185 intron probably benign
R6435:Tsc1 UTSW 2 28676452 missense probably benign 0.08
R6469:Tsc1 UTSW 2 28671886 splice site probably null
R6502:Tsc1 UTSW 2 28665601 missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28686989 missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28675732 missense probably benign 0.00
R7503:Tsc1 UTSW 2 28687076 missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28658736 missense probably benign 0.01
R7677:Tsc1 UTSW 2 28672817 missense probably benign 0.11
R7791:Tsc1 UTSW 2 28681948 missense probably damaging 1.00
R8021:Tsc1 UTSW 2 28686889 missense possibly damaging 0.67
R8228:Tsc1 UTSW 2 28676129 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AAAATCCCACCTCAGAGGGG -3'
(R):5'- TCACAGATCATCCCAGGCTC -3'

Sequencing Primer
(F):5'- CCTCAGAGGGGAGTGAGCTTTG -3'
(R):5'- GATCATCCCAGGCTCTACAC -3'
Posted On2016-06-06