Incidental Mutation 'R5020:Mmp24'
List |< first << previous [record 32 of 64] next >> last >|
ID389120
Institutional Source Beutler Lab
Gene Symbol Mmp24
Ensembl Gene ENSMUSG00000027612
Gene Namematrix metallopeptidase 24
SynonymsMembrane type 5-MMP, MT5-MMP
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location155775342-155818366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155810284 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 304 (E304G)
Ref Sequence ENSEMBL: ENSMUSP00000029141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029141]
Predicted Effect probably benign
Transcript: ENSMUST00000029141
AA Change: E304G

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029141
Gene: ENSMUSG00000027612
AA Change: E304G

DomainStartEndE-ValueType
signal peptide 1 42 N/A INTRINSIC
Pfam:PG_binding_1 52 107 6.9e-14 PFAM
ZnMc 132 301 1.78e-60 SMART
low complexity region 323 346 N/A INTRINSIC
HX 357 400 7.4e-9 SMART
HX 402 446 7.01e-10 SMART
HX 449 495 6.49e-14 SMART
HX 497 542 6.64e-11 SMART
Pfam:DUF3377 548 618 1.9e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135945
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein do not develop neuropathic pain with mechanical allodynia after sciatic nerve injury, display enhanced sensitivity to noxious thermal stimuli under basal conditions, and develop hyperalgesia during inflammation. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop neuropathic pain after peripheral nerve injury. They also experience reduced stress and enhanced mechanical coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Mmp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Mmp24 APN 2 155799887 missense probably damaging 1.00
IGL02089:Mmp24 APN 2 155812293 missense probably damaging 1.00
IGL02452:Mmp24 APN 2 155815788 missense probably damaging 1.00
R0600:Mmp24 UTSW 2 155792597 missense probably benign 0.01
R1381:Mmp24 UTSW 2 155814127 missense possibly damaging 0.46
R4497:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4498:Mmp24 UTSW 2 155813988 missense possibly damaging 0.85
R4727:Mmp24 UTSW 2 155815899 missense possibly damaging 0.55
R4985:Mmp24 UTSW 2 155814096 missense probably damaging 0.99
R5501:Mmp24 UTSW 2 155798136 missense probably damaging 1.00
R5686:Mmp24 UTSW 2 155799777 missense probably damaging 0.99
R5709:Mmp24 UTSW 2 155792542 missense probably damaging 1.00
R5773:Mmp24 UTSW 2 155799909 missense probably damaging 1.00
R6452:Mmp24 UTSW 2 155815753 missense possibly damaging 0.67
R6657:Mmp24 UTSW 2 155798179 missense probably damaging 1.00
R7015:Mmp24 UTSW 2 155792624 missense probably damaging 0.99
R7699:Mmp24 UTSW 2 155798176 missense probably damaging 0.99
R8076:Mmp24 UTSW 2 155807561 nonsense probably null
R8111:Mmp24 UTSW 2 155807425 missense possibly damaging 0.81
R8139:Mmp24 UTSW 2 155814045 nonsense probably null
R8304:Mmp24 UTSW 2 155799839 missense possibly damaging 0.85
R8344:Mmp24 UTSW 2 155810303 missense possibly damaging 0.68
Z1176:Mmp24 UTSW 2 155810392 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCAGAGCTGTTTCCATTTGTG -3'
(R):5'- GATCGCTCTCCGTACCTTGAAC -3'

Sequencing Primer
(F):5'- CCATTTGTGTTCTCAGAGACGG -3'
(R):5'- TCGGAAGAGGGCCACTGTG -3'
Posted On2016-06-06