Incidental Mutation 'R5020:Mecom'
ID389123
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene NameMDS1 and EVI1 complex locus
SynonymsEvi1, Jbo, D630039M04Rik, ZNFPR1B1, Evi-1, Prdm3, Mds1, MDS1-EVI1
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location29951296-30548008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29961106 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 823 (S823P)
Ref Sequence ENSEMBL: ENSMUSP00000134626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108270] [ENSMUST00000108271] [ENSMUST00000166001] [ENSMUST00000172694] [ENSMUST00000172697] [ENSMUST00000173495] [ENSMUST00000173899]
Predicted Effect unknown
Transcript: ENSMUST00000108270
AA Change: S814P
SMART Domains Protein: ENSMUSP00000103905
Gene: ENSMUSG00000027684
AA Change: S814P

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 724 746 5.29e-5 SMART
ZnF_C2H2 752 775 1.6e-4 SMART
ZnF_C2H2 781 803 5.9e-3 SMART
low complexity region 877 896 N/A INTRINSIC
low complexity region 1025 1040 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108271
AA Change: S567P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103906
Gene: ENSMUSG00000027684
AA Change: S567P

DomainStartEndE-ValueType
Blast:SET 9 85 3e-44 BLAST
PDB:2JV0|A 25 96 2e-12 PDB
ZnF_C2H2 98 118 1.86e1 SMART
ZnF_C2H2 152 174 4.47e-3 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 231 1.13e-4 SMART
ZnF_C2H2 237 259 1.2e-3 SMART
ZnF_C2H2 477 499 5.29e-5 SMART
ZnF_C2H2 505 528 1.6e-4 SMART
ZnF_C2H2 534 556 5.9e-3 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 778 793 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166001
AA Change: S823P

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128563
Gene: ENSMUSG00000027684
AA Change: S823P

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 5.29e-5 SMART
ZnF_C2H2 761 784 1.6e-4 SMART
ZnF_C2H2 790 812 5.9e-3 SMART
low complexity region 886 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172694
AA Change: S490P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134303
Gene: ENSMUSG00000027684
AA Change: S490P

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 400 422 5.29e-5 SMART
ZnF_C2H2 428 451 1.6e-4 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
low complexity region 553 572 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172697
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173059
AA Change: S614P
SMART Domains Protein: ENSMUSP00000133310
Gene: ENSMUSG00000027684
AA Change: S614P

DomainStartEndE-ValueType
SET 15 133 5.46e-15 SMART
ZnF_C2H2 146 166 1.86e1 SMART
ZnF_C2H2 200 222 4.47e-3 SMART
ZnF_C2H2 228 250 1.6e-4 SMART
ZnF_C2H2 256 279 1.13e-4 SMART
ZnF_C2H2 285 307 1.2e-3 SMART
ZnF_C2H2 525 547 5.29e-5 SMART
ZnF_C2H2 553 576 1.6e-4 SMART
ZnF_C2H2 582 604 5.9e-3 SMART
low complexity region 678 697 N/A INTRINSIC
low complexity region 826 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173495
AA Change: S823P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684
AA Change: S823P

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173899
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174413
AA Change: S479P
SMART Domains Protein: ENSMUSP00000134278
Gene: ENSMUSG00000027684
AA Change: S479P

DomainStartEndE-ValueType
ZnF_C2H2 11 31 1.86e1 SMART
ZnF_C2H2 65 87 4.47e-3 SMART
ZnF_C2H2 93 115 1.6e-4 SMART
ZnF_C2H2 121 144 1.13e-4 SMART
ZnF_C2H2 150 172 1.2e-3 SMART
ZnF_C2H2 390 412 5.29e-5 SMART
ZnF_C2H2 418 441 1.6e-4 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
low complexity region 543 562 N/A INTRINSIC
Meta Mutation Damage Score 0.0914 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 29963166 missense probably damaging 0.99
IGL02800:Mecom APN 3 29961034 missense probably damaging 1.00
IGL03052:Mecom APN 3 29960963 splice site probably benign
IGL03237:Mecom APN 3 29956499 intron probably benign
R0004:Mecom UTSW 3 29979911 missense probably damaging 1.00
R0299:Mecom UTSW 3 29980411 missense probably benign 0.41
R0324:Mecom UTSW 3 29963112 missense probably damaging 0.99
R0485:Mecom UTSW 3 29980972 intron probably benign
R0696:Mecom UTSW 3 29956389 missense probably benign 0.01
R1322:Mecom UTSW 3 29957373 missense probably damaging 0.98
R1396:Mecom UTSW 3 29979800 missense possibly damaging 0.50
R1419:Mecom UTSW 3 29980889 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1487:Mecom UTSW 3 29980064 missense probably damaging 1.00
R1620:Mecom UTSW 3 29987088 missense probably damaging 1.00
R1867:Mecom UTSW 3 30509428 critical splice donor site probably null
R1876:Mecom UTSW 3 29993658 missense probably damaging 1.00
R1922:Mecom UTSW 3 29957442 missense probably damaging 0.99
R2044:Mecom UTSW 3 29980592 missense probably damaging 1.00
R2087:Mecom UTSW 3 29952814 missense probably benign 0.01
R2116:Mecom UTSW 3 29965458 missense probably damaging 1.00
R3500:Mecom UTSW 3 29980912 missense probably damaging 1.00
R4348:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4350:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4351:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4352:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4353:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4358:Mecom UTSW 3 29979785 nonsense probably null
R4370:Mecom UTSW 3 29957355 missense probably damaging 1.00
R4380:Mecom UTSW 3 29987070 missense probably damaging 1.00
R4676:Mecom UTSW 3 30268668 intron probably benign
R4690:Mecom UTSW 3 30238310 missense probably benign 0.01
R4750:Mecom UTSW 3 29957530 missense probably damaging 0.97
R4812:Mecom UTSW 3 30140368 start codon destroyed probably null
R4821:Mecom UTSW 3 29985351 missense probably damaging 1.00
R4986:Mecom UTSW 3 29980699 missense probably damaging 0.99
R5099:Mecom UTSW 3 29985316 intron probably benign
R5410:Mecom UTSW 3 29997721 missense probably benign 0.01
R5415:Mecom UTSW 3 29957526 missense possibly damaging 0.93
R5556:Mecom UTSW 3 30238100 missense probably damaging 1.00
R5811:Mecom UTSW 3 29961000 missense probably benign 0.00
R5955:Mecom UTSW 3 29961046 missense probably damaging 1.00
R6153:Mecom UTSW 3 29993648 missense possibly damaging 0.92
R6321:Mecom UTSW 3 29980592 missense probably damaging 1.00
R6335:Mecom UTSW 3 29980756 missense probably damaging 1.00
R6383:Mecom UTSW 3 29997726 missense probably damaging 1.00
R6435:Mecom UTSW 3 29980249 missense probably damaging 1.00
R6468:Mecom UTSW 3 30140386 intron probably benign
R6476:Mecom UTSW 3 29980568 missense possibly damaging 0.70
R6673:Mecom UTSW 3 29980702 missense probably benign 0.09
R6721:Mecom UTSW 3 29979874 missense probably damaging 1.00
R7071:Mecom UTSW 3 29980708 missense probably damaging 1.00
R7095:Mecom UTSW 3 29980954 missense probably damaging 1.00
R7131:Mecom UTSW 3 29980945 missense probably damaging 1.00
R7247:Mecom UTSW 3 30140356 missense unknown
R7265:Mecom UTSW 3 29980133 missense possibly damaging 0.65
R7556:Mecom UTSW 3 29987071 missense probably benign 0.01
R7599:Mecom UTSW 3 29956385 missense probably damaging 0.96
R7609:Mecom UTSW 3 29956442 missense probably damaging 0.99
R7844:Mecom UTSW 3 30009824 missense unknown
R7927:Mecom UTSW 3 30009824 missense unknown
R8047:Mecom UTSW 3 30238255 missense
R8070:Mecom UTSW 3 29979838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCAGTAATAACTATAGTCCCGG -3'
(R):5'- TGGAGTCTCAGAACACTCTCAAG -3'

Sequencing Primer
(F):5'- GTAATAACTATAGTCCCGGGCACATG -3'
(R):5'- CAAGAGGCTTTCTCATGCGCATG -3'
Posted On2016-06-06