Incidental Mutation 'R5020:Actl6a'
ID389124
Institutional Source Beutler Lab
Gene Symbol Actl6a
Ensembl Gene ENSMUSG00000027671
Gene Nameactin-like 6A
Synonyms2810432C06Rik, Baf53a, ARP4, Actl6
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32706298-32726973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32720507 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 340 (I340V)
Ref Sequence ENSEMBL: ENSMUSP00000029214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000043966] [ENSMUST00000126144] [ENSMUST00000193615] [ENSMUST00000194781]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029214
AA Change: I340V

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671
AA Change: I340V

DomainStartEndE-ValueType
ACTIN 11 429 1.37e-189 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043966
SMART Domains Protein: ENSMUSP00000048078
Gene: ENSMUSG00000037531

DomainStartEndE-ValueType
Pfam:MRP-L47 66 151 4.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126144
SMART Domains Protein: ENSMUSP00000114317
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
ACTIN 1 204 4.28e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153779
Predicted Effect probably benign
Transcript: ENSMUST00000193231
Predicted Effect probably benign
Transcript: ENSMUST00000193615
SMART Domains Protein: ENSMUSP00000141354
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
Pfam:Actin 8 60 1.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194497
Predicted Effect probably benign
Transcript: ENSMUST00000194781
SMART Domains Protein: ENSMUSP00000141543
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
ACTIN 15 245 1.5e-32 SMART
Meta Mutation Damage Score 0.1627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E6.5. Mice homozygous for a conditional allele activated in hematopoietic cells exhibit bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Actl6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Actl6a APN 3 32712164 missense probably benign 0.01
IGL01691:Actl6a APN 3 32720200 missense possibly damaging 0.94
IGL02902:Actl6a APN 3 32722642 missense possibly damaging 0.93
R0194:Actl6a UTSW 3 32725320 missense probably damaging 1.00
R1193:Actl6a UTSW 3 32712144 missense probably benign 0.00
R1404:Actl6a UTSW 3 32722610 unclassified probably benign
R1754:Actl6a UTSW 3 32718574 missense probably damaging 1.00
R4289:Actl6a UTSW 3 32712114 missense possibly damaging 0.87
R5165:Actl6a UTSW 3 32720208 missense probably benign 0.01
R5272:Actl6a UTSW 3 32718610 missense probably damaging 0.97
R5384:Actl6a UTSW 3 32720493 missense probably damaging 1.00
R5640:Actl6a UTSW 3 32718050 missense probably damaging 0.99
R5722:Actl6a UTSW 3 32718045 missense probably damaging 0.97
R5865:Actl6a UTSW 3 32712128 missense possibly damaging 0.80
R6208:Actl6a UTSW 3 32711894 missense probably benign 0.05
R7094:Actl6a UTSW 3 32706338 start gained probably benign
R7192:Actl6a UTSW 3 32720224 missense probably damaging 1.00
R7866:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
R7949:Actl6a UTSW 3 32712113 missense possibly damaging 0.87
Z1176:Actl6a UTSW 3 32726543 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGACCCTTCCAACGTAAAGG -3'
(R):5'- CAGAAGACTTGTGGCAATCCAG -3'

Sequencing Primer
(F):5'- CCCTTCCAACGTAAAGGTGTGAAAG -3'
(R):5'- TTGTGGCAATCCAGGAGCTCAG -3'
Posted On2016-06-06