Incidental Mutation 'R5020:Rasa4'
List |< first << previous [record 47 of 64] next >> last >|
ID389131
Institutional Source Beutler Lab
Gene Symbol Rasa4
Ensembl Gene ENSMUSG00000004952
Gene NameRAS p21 protein activator 4
Synonyms
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location136083916-136111860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 136101299 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 303 (Q303P)
Ref Sequence ENSEMBL: ENSMUSP00000098136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042135] [ENSMUST00000100570]
Predicted Effect probably damaging
Transcript: ENSMUST00000042135
AA Change: Q303P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037869
Gene: ENSMUSG00000004952
AA Change: Q303P

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 604 3.47e-139 SMART
PH 566 674 1.81e-11 SMART
BTK 674 710 3.6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100570
AA Change: Q303P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098136
Gene: ENSMUSG00000004952
AA Change: Q303P

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 558 3.48e-89 SMART
PH 520 628 1.81e-11 SMART
BTK 628 664 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122887
SMART Domains Protein: ENSMUSP00000118929
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
PH 6 103 1.36e-6 SMART
BTK 103 141 5.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140972
Predicted Effect probably benign
Transcript: ENSMUST00000145294
SMART Domains Protein: ENSMUSP00000120203
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
C2 5 68 1.88e-2 SMART
Blast:RasGAP 80 121 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184713
Meta Mutation Damage Score 0.4791 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an increased sensitivity to bacterial infections which involves reduced phagocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Rasa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rasa4 APN 5 136101993 missense possibly damaging 0.95
IGL01364:Rasa4 APN 5 136095571 missense possibly damaging 0.83
IGL01835:Rasa4 APN 5 136102607 missense possibly damaging 0.95
IGL02284:Rasa4 APN 5 136101691 critical splice donor site probably null
IGL02332:Rasa4 APN 5 136095599 missense probably benign 0.02
IGL03197:Rasa4 APN 5 136102012 missense probably damaging 1.00
R0729:Rasa4 UTSW 5 136102070 splice site probably benign
R0782:Rasa4 UTSW 5 136104532 missense possibly damaging 0.94
R1124:Rasa4 UTSW 5 136105656 missense probably benign 0.07
R1673:Rasa4 UTSW 5 136104637 missense probably benign 0.12
R1902:Rasa4 UTSW 5 136091238 missense probably benign 0.01
R2357:Rasa4 UTSW 5 136091247 missense probably damaging 1.00
R2427:Rasa4 UTSW 5 136102027 missense probably benign 0.24
R2880:Rasa4 UTSW 5 136091771 missense probably damaging 1.00
R3818:Rasa4 UTSW 5 136102293 missense possibly damaging 0.65
R4647:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R4782:Rasa4 UTSW 5 136091229 nonsense probably null
R4837:Rasa4 UTSW 5 136091810 critical splice donor site probably null
R4863:Rasa4 UTSW 5 136103911 nonsense probably null
R5729:Rasa4 UTSW 5 136093162 missense probably benign
R6606:Rasa4 UTSW 5 136103947 missense probably damaging 1.00
R6750:Rasa4 UTSW 5 136100948 missense probably benign 0.12
R7009:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R7158:Rasa4 UTSW 5 136102021 missense probably damaging 0.99
R7358:Rasa4 UTSW 5 136095594 missense probably benign 0.03
R8303:Rasa4 UTSW 5 136089381 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCAATAAACTGATCCCCGGG -3'
(R):5'- TGGAGTCTTTAGCCCCTCAG -3'

Sequencing Primer
(F):5'- ATAAACTGATCCCCGGGTCTGAG -3'
(R):5'- GGAGTCTTTAGCCCCTCAGTAAATG -3'
Posted On2016-06-06