Mutagenetix > Incidental Mutations

Incidental Mutation 'R5020:Grin2b'

389135

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

042611-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135733407 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1047 (D1047G)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: D1047G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D1047G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: D1047G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D1047G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Meta Mutation Damage Score

0.1955

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,282,502	D70G	probably benign	Het
Acadsb	A	T	7: 131,441,200		probably null	Het
Actl6a	A	G	3: 32,720,507	I340V	possibly damaging	Het
Alppl2	C	T	1: 87,089,709	V19I	probably benign	Het
Ankrd34c	T	C	9: 89,729,706	K194R	probably benign	Het
Anpep	T	A	7: 79,833,727	M672L	probably benign	Het
Arhgap31	T	C	16: 38,603,076	D876G	probably damaging	Het
Arid2	T	A	15: 96,371,988	N1327K	probably damaging	Het
Atp5d	C	A	10: 80,145,429	P101Q	probably benign	Het
Bcl7b	G	A	5: 135,171,163		probably null	Het
Brca2	A	T	5: 150,560,436	S2907C	probably damaging	Het
Ccser2	T	C	14: 36,940,177	E350G	probably benign	Het
Cdh23	G	T	10: 60,308,032	D2929E	probably damaging	Het
Clec2i	T	A	6: 128,893,658	V78E	probably benign	Het
Cpxm1	A	T	2: 130,395,977		probably null	Het
Crybg3	C	T	16: 59,554,796	V2032I	possibly damaging	Het
Eif5b	A	T	1: 38,019,069	K151*	probably null	Het
Gemin7	T	A	7: 19,565,423	E82D	possibly damaging	Het
Gm14496	A	G	2: 181,991,359	E45G	possibly damaging	Het
Gm20767	T	C	13: 120,155,116	F164L	possibly damaging	Het
Gm21915	T	C	9: 40,670,670	S20P	probably damaging	Het
Gm8126	A	C	14: 43,261,569	E165A	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Ikbke	T	A	1: 131,273,660	Y150F	probably damaging	Het
Itih5	T	A	2: 10,240,504		probably null	Het
Lrig2	T	C	3: 104,457,901	Q645R	possibly damaging	Het
Map4	A	G	9: 110,068,800	M712V	probably benign	Het
Mecom	A	G	3: 29,961,106	S823P	probably damaging	Het
Mettl25	A	G	10: 105,826,207	Y301H	possibly damaging	Het
Mga	A	T	2: 119,951,173	K2136*	probably null	Het
Mmp24	A	G	2: 155,810,284	E304G	probably benign	Het
Mmp3	T	A	9: 7,445,984	D29E	probably benign	Het
Nbas	T	A	12: 13,374,712	I984N	probably damaging	Het
Nedd9	A	G	13: 41,315,794	Y628H	probably damaging	Het
Nlrp2	C	T	7: 5,328,077	C440Y	probably damaging	Het
Olfr1279	T	C	2: 111,306,292	V29A	probably benign	Het
Olfr414	T	G	1: 174,430,671	L81R	probably damaging	Het
P4ha2	T	C	11: 54,131,190	V513A	probably damaging	Het
Pcsk4	T	C	10: 80,326,035	N124S	probably benign	Het
Phf12	T	C	11: 78,023,796	F139S	probably damaging	Het
Phlpp2	T	A	8: 109,940,082	L1081H	probably damaging	Het
Phospho2	T	A	2: 69,795,979	F160I	probably damaging	Het
Plch2	T	G	4: 155,007,083	D115A	probably damaging	Het
Plekho1	A	G	3: 95,989,539	F215S	probably damaging	Het
Psma4	C	A	9: 54,952,772	A47E	probably damaging	Het
Rasa4	A	C	5: 136,101,299	Q303P	probably damaging	Het
Rbmxl2	C	T	7: 107,210,207	P233L	probably damaging	Het
Reln	A	T	5: 22,034,638	L877H	probably damaging	Het
Rtel1	A	G	2: 181,322,514		probably null	Het
Sept12	T	C	16: 4,993,756	D116G	probably damaging	Het
Son	T	A	16: 91,656,375	V670E	probably damaging	Het
Spag9	T	A	11: 94,097,786	I544N	probably benign	Het
Spsb3	T	G	17: 24,887,062		probably benign	Het
Tgfbr3	T	C	5: 107,214,970	T59A	probably damaging	Het
Tsc1	T	A	2: 28,676,519	I649K	probably damaging	Het
Txndc9	T	C	1: 37,995,712	D37G	probably benign	Het
Uba7	C	T	9: 107,978,914	A496V	probably benign	Het
Usf3	T	A	16: 44,215,526	I123N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,530	S234T	possibly damaging	Het
Vsig10l	C	A	7: 43,465,317	S314*	probably null	Het
Wdfy4	A	G	14: 33,079,935	F1922S	probably damaging	Het
Zfp219	C	T	14: 52,009,655	R5H	probably damaging	Het
Zfp946	G	T	17: 22,455,603	C446F	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCAAACTCCCTCCTAGATTTGG -3'
(R):5'- GAGAACATTTGGCAACCTGC -3'

Sequencing Primer
(F):5'- TCCTAGATTTGGCCGAGGC -3'
(R):5'- CTGAAGGACAGCAATGTGTACC -3'

Posted On

2016-06-06