Incidental Mutation 'R5020:Gemin7'
ID389137
Institutional Source Beutler Lab
Gene Symbol Gemin7
Ensembl Gene ENSMUSG00000044709
Gene Namegem nuclear organelle associated protein 7
Synonyms
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19564946-19577595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19565423 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 82 (E82D)
Ref Sequence ENSEMBL: ENSMUSP00000113709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051364] [ENSMUST00000058444] [ENSMUST00000117222] [ENSMUST00000119912] [ENSMUST00000122055] [ENSMUST00000122127] [ENSMUST00000151646] [ENSMUST00000208826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051364
AA Change: E82D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055844
Gene: ENSMUSG00000044709
AA Change: E82D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058444
SMART Domains Protein: ENSMUSP00000060233
Gene: ENSMUSG00000051403

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
Blast:LRR 139 166 1e-9 BLAST
LRR 224 251 1.77e2 SMART
LRR 252 280 3.52e-1 SMART
LRR 281 308 8.27e-7 SMART
LRR 310 337 3.05e1 SMART
LRR 338 365 1.4e-4 SMART
LRR 366 393 1.56e-2 SMART
LRR 394 421 2.36e-2 SMART
low complexity region 504 540 N/A INTRINSIC
low complexity region 566 574 N/A INTRINSIC
low complexity region 596 628 N/A INTRINSIC
low complexity region 660 679 N/A INTRINSIC
low complexity region 696 702 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117222
AA Change: E82D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113266
Gene: ENSMUSG00000044709
AA Change: E82D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119912
AA Change: E82D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112742
Gene: ENSMUSG00000044709
AA Change: E82D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122055
AA Change: E82D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113583
Gene: ENSMUSG00000044709
AA Change: E82D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122127
AA Change: E82D

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113709
Gene: ENSMUSG00000044709
AA Change: E82D

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 129 1.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151646
SMART Domains Protein: ENSMUSP00000116207
Gene: ENSMUSG00000044709

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:Gemin7 50 81 7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208826
AA Change: E82D

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the core SMN complex, which is required for pre-mRNA splicing in the nucleus. The encoded protein is found in the nucleoplasm, in nuclear "gems" (Gemini of Cajal bodies), and in the cytoplasm. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Gemin7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02750:Gemin7 APN 7 19565419 missense probably null 1.00
PIT4377001:Gemin7 UTSW 7 19565317 nonsense probably null
R5896:Gemin7 UTSW 7 19565298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCAGAGTTTGTTGGAGATTG -3'
(R):5'- TTGCCTCTGATGGACGTAGG -3'

Sequencing Primer
(F):5'- CTCTATGTCCCAGGAATAGTCAGAG -3'
(R):5'- GGACCATCCTGAGACCAGAAGTC -3'
Posted On2016-06-06