Incidental Mutation 'R5020:Anpep'
ID389141
Institutional Source Beutler Lab
Gene Symbol Anpep
Ensembl Gene ENSMUSG00000039062
Gene Namealanyl (membrane) aminopeptidase
Synonymsaminopeptidase N, Cd13, Apn
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79821803-79861059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79833727 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 672 (M672L)
Ref Sequence ENSEMBL: ENSMUSP00000103015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502]
Predicted Effect probably benign
Transcript: ENSMUST00000049004
AA Change: M672L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: M672L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 6.3e-142 PFAM
Pfam:Peptidase_MA_2 355 502 1.4e-21 PFAM
Pfam:ERAP1_C 618 944 2.9e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107392
AA Change: M672L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: M672L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
Pfam:Peptidase_M1 75 479 2.5e-139 PFAM
Pfam:ERAP1_C 618 943 2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206387
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Anpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Anpep APN 7 79825736 missense possibly damaging 0.64
IGL00089:Anpep APN 7 79841986 missense probably damaging 1.00
IGL00767:Anpep APN 7 79840890 missense probably benign 0.00
IGL00901:Anpep APN 7 79839423 missense probably benign
IGL01919:Anpep APN 7 79825350 missense possibly damaging 0.77
IGL02049:Anpep APN 7 79835181 missense probably damaging 0.97
IGL02195:Anpep APN 7 79826685 missense probably damaging 1.00
IGL02210:Anpep APN 7 79826904 missense probably benign 0.00
IGL02584:Anpep APN 7 79825393 splice site probably benign
IGL02677:Anpep APN 7 79838730 missense probably damaging 1.00
IGL03073:Anpep APN 7 79838955 missense probably damaging 1.00
IGL03100:Anpep APN 7 79836361 missense probably benign 0.01
PIT4696001:Anpep UTSW 7 79839464 missense possibly damaging 0.85
R0329:Anpep UTSW 7 79838256 missense probably benign 0.01
R0330:Anpep UTSW 7 79838256 missense probably benign 0.01
R0619:Anpep UTSW 7 79841009 missense probably benign
R0691:Anpep UTSW 7 79839299 missense probably damaging 0.98
R1004:Anpep UTSW 7 79838256 missense probably benign 0.01
R1005:Anpep UTSW 7 79838256 missense probably benign 0.01
R1274:Anpep UTSW 7 79838256 missense probably benign 0.01
R1288:Anpep UTSW 7 79838256 missense probably benign 0.01
R1289:Anpep UTSW 7 79838256 missense probably benign 0.01
R1532:Anpep UTSW 7 79826948 nonsense probably null
R1540:Anpep UTSW 7 79838256 missense probably benign 0.01
R1574:Anpep UTSW 7 79838407 splice site probably null
R1574:Anpep UTSW 7 79838407 splice site probably null
R1618:Anpep UTSW 7 79835417 missense probably benign 0.00
R1627:Anpep UTSW 7 79842011 missense probably benign
R1693:Anpep UTSW 7 79838256 missense probably benign 0.01
R1717:Anpep UTSW 7 79838256 missense probably benign 0.01
R1745:Anpep UTSW 7 79838256 missense probably benign 0.01
R1746:Anpep UTSW 7 79838256 missense probably benign 0.01
R1748:Anpep UTSW 7 79838256 missense probably benign 0.01
R1809:Anpep UTSW 7 79841823 missense probably benign 0.01
R1901:Anpep UTSW 7 79838256 missense probably benign 0.01
R1902:Anpep UTSW 7 79838256 missense probably benign 0.01
R1903:Anpep UTSW 7 79838256 missense probably benign 0.01
R1985:Anpep UTSW 7 79840857 unclassified probably null
R2379:Anpep UTSW 7 79841218 missense probably benign 0.28
R2508:Anpep UTSW 7 79838291 missense possibly damaging 0.80
R3110:Anpep UTSW 7 79841972 missense probably benign 0.15
R3112:Anpep UTSW 7 79841972 missense probably benign 0.15
R3898:Anpep UTSW 7 79839225 missense probably benign 0.07
R3899:Anpep UTSW 7 79839225 missense probably benign 0.07
R3900:Anpep UTSW 7 79839225 missense probably benign 0.07
R4211:Anpep UTSW 7 79840996 nonsense probably null
R4701:Anpep UTSW 7 79839465 missense probably benign 0.16
R4716:Anpep UTSW 7 79826632 missense probably benign 0.00
R5042:Anpep UTSW 7 79839469 missense probably benign 0.00
R5084:Anpep UTSW 7 79826870 critical splice donor site probably null
R5319:Anpep UTSW 7 79841731 missense probably benign
R5593:Anpep UTSW 7 79842046 missense probably benign 0.04
R5778:Anpep UTSW 7 79836391 missense probably benign 0.00
R5852:Anpep UTSW 7 79838972 nonsense probably null
R5906:Anpep UTSW 7 79833675 missense probably benign
R6164:Anpep UTSW 7 79842205 missense possibly damaging 0.68
R6254:Anpep UTSW 7 79839233 missense probably damaging 1.00
R6284:Anpep UTSW 7 79825802 missense probably damaging 1.00
R6380:Anpep UTSW 7 79841896 missense probably benign 0.04
R6594:Anpep UTSW 7 79841361 intron probably null
R6746:Anpep UTSW 7 79839185 intron probably null
R6920:Anpep UTSW 7 79825349 missense probably damaging 1.00
R7060:Anpep UTSW 7 79841794 missense probably benign 0.33
R7072:Anpep UTSW 7 79835379 missense possibly damaging 0.58
R7095:Anpep UTSW 7 79842202 missense possibly damaging 0.87
R7102:Anpep UTSW 7 79836313 missense probably benign 0.00
R7178:Anpep UTSW 7 79840988 missense probably benign
R7223:Anpep UTSW 7 79825310 missense probably damaging 1.00
R7344:Anpep UTSW 7 79838650 missense possibly damaging 0.60
R7441:Anpep UTSW 7 79827644 missense possibly damaging 0.93
R7479:Anpep UTSW 7 79835370 missense probably benign 0.11
R7503:Anpep UTSW 7 79826637 missense probably damaging 1.00
R7683:Anpep UTSW 7 79839198 missense probably damaging 0.98
R7912:Anpep UTSW 7 79838426 missense probably benign 0.00
R7993:Anpep UTSW 7 79838426 missense probably benign 0.00
R8036:Anpep UTSW 7 79841898 missense probably benign 0.11
R8039:Anpep UTSW 7 79839400 critical splice donor site probably null
Z1176:Anpep UTSW 7 79827639 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GATCCATTACTCTGTGACACCAC -3'
(R):5'- TGGTGGCGTCACAAAGCATC -3'

Sequencing Primer
(F):5'- AGTATACTGCCCAGTGGTGCAG -3'
(R):5'- GCGTCACAAAGCATCTGTGTC -3'
Posted On2016-06-06