Incidental Mutation 'R5020:Rbmxl2'
List |< first << previous [record 48 of 64] next >> last >|
ID389142
Institutional Source Beutler Lab
Gene Symbol Rbmxl2
Ensembl Gene ENSMUSG00000073894
Gene NameRNA binding motif protein, X-linked-like 2
Synonyms1700012H05Rik
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5020 (G1)
Quality Score194
Status Validated
Chromosome7
Chromosomal Location107209445-107210916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107210207 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 233 (P233L)
Ref Sequence ENSEMBL: ENSMUSP00000095739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098135]
Predicted Effect probably damaging
Transcript: ENSMUST00000098135
AA Change: P233L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095739
Gene: ENSMUSG00000073894
AA Change: P233L

DomainStartEndE-ValueType
RRM 9 82 1.12e-26 SMART
low complexity region 91 125 N/A INTRINSIC
Pfam:RBM1CTR 169 214 9.9e-21 PFAM
Blast:RRM 219 250 5e-11 BLAST
low complexity region 285 307 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
low complexity region 358 384 N/A INTRINSIC
Meta Mutation Damage Score 0.3031 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HNRPG subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind RNAs. This gene is intronless and is thought to be derived from a processed retroposon. However, unlike many retroposon-derived genes, this gene is not a pseudogene. The encoded protein has similarity to HNRPG and RBMY proteins and it is suggested to replace HNRPG protein function during meiotic prophase or act as a germ cell-specific splicing regulator. It primarily localizes to the nuclei of meiotic spermatocytes. This gene is a candidate for autosomal male infertility. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Rbmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03147:Rbmxl2 UTSW 7 107209651 missense probably benign 0.00
R1958:Rbmxl2 UTSW 7 107210198 missense probably benign 0.06
R2435:Rbmxl2 UTSW 7 107210331 missense probably damaging 1.00
R3107:Rbmxl2 UTSW 7 107210417 missense probably damaging 0.98
R5243:Rbmxl2 UTSW 7 107209837 missense probably damaging 0.99
R5444:Rbmxl2 UTSW 7 107209837 missense probably damaging 0.99
R8032:Rbmxl2 UTSW 7 107210222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAGGCCATCAAAGTGGC -3'
(R):5'- AGCCTCGGTACTCGTCATAG -3'

Sequencing Primer
(F):5'- TACACGGGGGATTTCGACCTG -3'
(R):5'- TACTCGTCATAGCGGCCC -3'
Posted On2016-06-06