Incidental Mutation 'R5020:Acadsb'
ID389143
Institutional Source Beutler Lab
Gene Symbol Acadsb
Ensembl Gene ENSMUSG00000030861
Gene Nameacyl-Coenzyme A dehydrogenase, short/branched chain
Synonyms1300003O09Rik
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131410601-131448944 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 131441200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015829] [ENSMUST00000117518] [ENSMUST00000124096]
Predicted Effect probably null
Transcript: ENSMUST00000015829
SMART Domains Protein: ENSMUSP00000015829
Gene: ENSMUSG00000030861

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 9.9e-30 PFAM
Pfam:Acyl-CoA_dh_M 173 268 6.9e-29 PFAM
Pfam:Acyl-CoA_dh_1 280 428 6.5e-51 PFAM
Pfam:Acyl-CoA_dh_2 295 418 4.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117518
SMART Domains Protein: ENSMUSP00000113948
Gene: ENSMUSG00000030861

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 58 170 2.9e-29 PFAM
Pfam:Acyl-CoA_dh_M 173 268 1.2e-28 PFAM
Pfam:Acyl-CoA_dh_1 280 414 1.4e-41 PFAM
Pfam:Acyl-CoA_dh_2 295 415 2.6e-24 PFAM
transmembrane domain 417 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208795
Meta Mutation Damage Score 0.9596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short/branched chain acyl-CoA dehydrogenase(ACADSB) is a member of the acyl-CoA dehydrogenase family of enzymes that catalyze the dehydrogenation of acyl-CoA derivatives in the metabolism of fatty acids or branch chained amino acids. Substrate specificity is the primary characteristic used to define members of this gene family. The ACADSB gene product has the greatest activity towards the short branched chain acyl-CoA derivative, (S)-2-methylbutyryl-CoA, but also reacts significantly with other 2-methyl branched chain substrates and with short straight chain acyl-CoAs. The cDNA encodes for a mitochondrial precursor protein which is cleaved upon mitochondrial import and predicted to yield a mature peptide of approximately 43.7-KDa. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Acadsb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Acadsb APN 7 131437496 intron probably benign
IGL02002:Acadsb APN 7 131428529 missense probably damaging 1.00
IGL02147:Acadsb APN 7 131425881 splice site probably benign
IGL02614:Acadsb APN 7 131424628 missense probably benign 0.00
IGL03038:Acadsb APN 7 131428456 missense probably damaging 1.00
IGL03083:Acadsb APN 7 131441193 intron probably benign
R0491:Acadsb UTSW 7 131430107 missense probably benign 0.41
R0562:Acadsb UTSW 7 131425789 nonsense probably null
R0989:Acadsb UTSW 7 131428544 missense probably damaging 0.99
R1701:Acadsb UTSW 7 131424484 missense probably benign 0.00
R1827:Acadsb UTSW 7 131441275 missense probably damaging 1.00
R1860:Acadsb UTSW 7 131444229 splice site probably null
R2256:Acadsb UTSW 7 131443653 missense probably benign 0.23
R3798:Acadsb UTSW 7 131431965 missense probably damaging 1.00
R4519:Acadsb UTSW 7 131430004 missense probably damaging 0.99
R5048:Acadsb UTSW 7 131437469 missense probably damaging 1.00
R5243:Acadsb UTSW 7 131444243 missense probably damaging 1.00
R5519:Acadsb UTSW 7 131429965 missense probably damaging 1.00
R5788:Acadsb UTSW 7 131443599 missense probably benign 0.23
R5855:Acadsb UTSW 7 131424599 missense probably damaging 1.00
R6399:Acadsb UTSW 7 131430055 missense probably damaging 1.00
R6896:Acadsb UTSW 7 131443646 missense probably benign 0.23
R6970:Acadsb UTSW 7 131434315 missense possibly damaging 0.85
R7031:Acadsb UTSW 7 131443637 missense probably benign 0.23
R7126:Acadsb UTSW 7 131437448 missense probably benign 0.01
R7138:Acadsb UTSW 7 131441239 missense probably damaging 1.00
R7571:Acadsb UTSW 7 131443554 missense probably damaging 1.00
R7697:Acadsb UTSW 7 131429969 missense probably damaging 1.00
R8271:Acadsb UTSW 7 131443694 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAACCTAACCTTTTACGGTGC -3'
(R):5'- GTAACACATCTTCCCACGGCAG -3'

Sequencing Primer
(F):5'- AACCTTTTACGGTGCTATTTAAAATC -3'
(R):5'- TGCCCTTCTACTGCAGGAAGTG -3'
Posted On2016-06-06