Incidental Mutation 'R5020:Phf12'
List |< first << previous [record 41 of 64] next >> last >|
ID389158
Institutional Source Beutler Lab
Gene Symbol Phf12
Ensembl Gene ENSMUSG00000037791
Gene NamePHD finger protein 12
Synonyms2410142K10Rik, PF1
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R5020 (G1)
Quality Score208
Status Validated
Chromosome11
Chromosomal Location77982754-78030539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78023796 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 139 (F139S)
Ref Sequence ENSEMBL: ENSMUSP00000119390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049167] [ENSMUST00000108360] [ENSMUST00000131680] [ENSMUST00000153428]
Predicted Effect probably benign
Transcript: ENSMUST00000049167
AA Change: F688S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044990
Gene: ENSMUSG00000037791
AA Change: F688S

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
Pfam:PHF12_MRG_bd 202 241 1.3e-21 PFAM
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Blast:FHA 813 868 9e-34 BLAST
low complexity region 905 916 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108360
AA Change: F688S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103997
Gene: ENSMUSG00000037791
AA Change: F688S

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
PHD 58 103 7.23e-11 SMART
low complexity region 182 200 N/A INTRINSIC
PDB:2L9S|A 201 241 2e-20 PDB
PHD 273 319 1.66e-10 SMART
low complexity region 616 630 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123662
AA Change: F26S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125079
Predicted Effect possibly damaging
Transcript: ENSMUST00000131680
AA Change: F34S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141620
Predicted Effect probably damaging
Transcript: ENSMUST00000153428
AA Change: F139S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119390
Gene: ENSMUSG00000037791
AA Change: F139S

DomainStartEndE-ValueType
low complexity region 67 81 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153747
AA Change: F56S
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Phf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Phf12 APN 11 78015506 missense probably damaging 0.98
IGL00919:Phf12 APN 11 77983340 missense probably damaging 1.00
IGL01434:Phf12 APN 11 78023559 missense probably damaging 1.00
IGL02219:Phf12 APN 11 77984196 missense probably damaging 0.97
IGL02727:Phf12 APN 11 78023667 missense possibly damaging 0.83
IGL03064:Phf12 APN 11 77983360 missense probably damaging 1.00
IGL03117:Phf12 APN 11 78023020 unclassified probably benign
R0457:Phf12 UTSW 11 78018168 missense possibly damaging 0.94
R0477:Phf12 UTSW 11 78023070 missense possibly damaging 0.94
R0656:Phf12 UTSW 11 78029332 missense probably benign 0.44
R0905:Phf12 UTSW 11 78009404 nonsense probably null
R1719:Phf12 UTSW 11 78023601 missense probably damaging 1.00
R1742:Phf12 UTSW 11 78009486 missense probably benign 0.04
R1826:Phf12 UTSW 11 78024954 splice site probably benign
R2270:Phf12 UTSW 11 77984175 missense possibly damaging 0.82
R2875:Phf12 UTSW 11 78009747 missense probably damaging 1.00
R2885:Phf12 UTSW 11 78023769 missense possibly damaging 0.75
R5570:Phf12 UTSW 11 78018111 missense possibly damaging 0.89
R5573:Phf12 UTSW 11 78025045 missense probably damaging 1.00
R5689:Phf12 UTSW 11 78023725 missense probably damaging 1.00
R5727:Phf12 UTSW 11 78023544 missense probably damaging 1.00
R5807:Phf12 UTSW 11 78022426 missense probably benign 0.16
R5910:Phf12 UTSW 11 78027398 missense probably damaging 1.00
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6034:Phf12 UTSW 11 78018069 missense probably benign 0.08
R6049:Phf12 UTSW 11 78028170 unclassified probably null
R6052:Phf12 UTSW 11 78018218 missense probably benign 0.31
R6056:Phf12 UTSW 11 78009515 missense probably benign 0.09
R6208:Phf12 UTSW 11 78023591 missense probably damaging 0.97
R6644:Phf12 UTSW 11 78026092 makesense probably null
R6805:Phf12 UTSW 11 78027373 missense probably damaging 1.00
R6823:Phf12 UTSW 11 78022511 nonsense probably null
R7047:Phf12 UTSW 11 78013273 missense probably damaging 0.99
R7159:Phf12 UTSW 11 78023540 missense possibly damaging 0.76
R7602:Phf12 UTSW 11 78023283 missense probably benign
R7618:Phf12 UTSW 11 78026134 missense unknown
R8162:Phf12 UTSW 11 78024825 missense probably damaging 0.99
R8290:Phf12 UTSW 11 78029639 missense probably benign 0.02
X0013:Phf12 UTSW 11 78009791 missense probably damaging 1.00
X0027:Phf12 UTSW 11 78028895 unclassified probably null
Predicted Primers PCR Primer
(F):5'- AGTTTGGTACCCGTCCCAAG -3'
(R):5'- GCTAACACAGCCTTTCATCTG -3'

Sequencing Primer
(F):5'- CCCAGCTCTTGTGCCAG -3'
(R):5'- ACAGCCTTTCATCTGCCATAAG -3'
Posted On2016-06-06