Mutagenetix > Incidental Mutations

Incidental Mutation 'R5020:Nbas'

389160

Institutional Source

Beutler Lab

Gene Symbol

Nbas

Ensembl Gene

ENSMUSG00000020576

Gene Name

neuroblastoma amplified sequence

Synonyms

4933425L03Rik

MMRRC Submission

042611-MU

Accession Numbers

Genbank: NM_027706.1; Ensembl: ENSMUST00000042953

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5020 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13269133-13583811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13374712 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 984 (I984N)

Ref Sequence

ENSEMBL: ENSMUSP00000036082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042953]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042953
AA Change: I984N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000036082
Gene: ENSMUSG00000020576
AA Change: I984N

Domain	Start	End	E-Value	Type
Pfam:Nbas_N	89	370	4.7e-171	PFAM
low complexity region	463	475	N/A	INTRINSIC
low complexity region	653	667	N/A	INTRINSIC
Pfam:Sec39	725	1375	3.8e-34	PFAM
low complexity region	1392	1404	N/A	INTRINSIC
low complexity region	1549	1566	N/A	INTRINSIC
low complexity region	2226	2252	N/A	INTRINSIC
low complexity region	2275	2285	N/A	INTRINSIC

Meta Mutation Damage Score

0.3942

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.1%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two leucine zipper domains, a ribosomal protein S14 signature domain and a Sec39 like domain. The protein is thought to be involved in Golgi-to-ER transport. Mutations in this gene are associated with short stature, optic nerve atrophy, and Pelger-Huet anomaly. [provided by RefSeq, Oct 2012]

Allele List at MGI

All alleles(10) : Targeted, other(2) Gene trapped(8)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	C	9: 103,282,502	D70G	probably benign	Het
Acadsb	A	T	7: 131,441,200		probably null	Het
Actl6a	A	G	3: 32,720,507	I340V	possibly damaging	Het
Alppl2	C	T	1: 87,089,709	V19I	probably benign	Het
Ankrd34c	T	C	9: 89,729,706	K194R	probably benign	Het
Anpep	T	A	7: 79,833,727	M672L	probably benign	Het
Arhgap31	T	C	16: 38,603,076	D876G	probably damaging	Het
Arid2	T	A	15: 96,371,988	N1327K	probably damaging	Het
Atp5d	C	A	10: 80,145,429	P101Q	probably benign	Het
Bcl7b	G	A	5: 135,171,163		probably null	Het
Brca2	A	T	5: 150,560,436	S2907C	probably damaging	Het
Ccser2	T	C	14: 36,940,177	E350G	probably benign	Het
Cdh23	G	T	10: 60,308,032	D2929E	probably damaging	Het
Clec2i	T	A	6: 128,893,658	V78E	probably benign	Het
Cpxm1	A	T	2: 130,395,977		probably null	Het
Crybg3	C	T	16: 59,554,796	V2032I	possibly damaging	Het
Eif5b	A	T	1: 38,019,069	K151*	probably null	Het
Gemin7	T	A	7: 19,565,423	E82D	possibly damaging	Het
Gm14496	A	G	2: 181,991,359	E45G	possibly damaging	Het
Gm20767	T	C	13: 120,155,116	F164L	possibly damaging	Het
Gm21915	T	C	9: 40,670,670	S20P	probably damaging	Het
Gm8126	A	C	14: 43,261,569	E165A	probably damaging	Het
Grin2b	T	C	6: 135,733,407	D1047G	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Ikbke	T	A	1: 131,273,660	Y150F	probably damaging	Het
Itih5	T	A	2: 10,240,504		probably null	Het
Lrig2	T	C	3: 104,457,901	Q645R	possibly damaging	Het
Map4	A	G	9: 110,068,800	M712V	probably benign	Het
Mecom	A	G	3: 29,961,106	S823P	probably damaging	Het
Mettl25	A	G	10: 105,826,207	Y301H	possibly damaging	Het
Mga	A	T	2: 119,951,173	K2136*	probably null	Het
Mmp24	A	G	2: 155,810,284	E304G	probably benign	Het
Mmp3	T	A	9: 7,445,984	D29E	probably benign	Het
Nedd9	A	G	13: 41,315,794	Y628H	probably damaging	Het
Nlrp2	C	T	7: 5,328,077	C440Y	probably damaging	Het
Olfr1279	T	C	2: 111,306,292	V29A	probably benign	Het
Olfr414	T	G	1: 174,430,671	L81R	probably damaging	Het
P4ha2	T	C	11: 54,131,190	V513A	probably damaging	Het
Pcsk4	T	C	10: 80,326,035	N124S	probably benign	Het
Phf12	T	C	11: 78,023,796	F139S	probably damaging	Het
Phlpp2	T	A	8: 109,940,082	L1081H	probably damaging	Het
Phospho2	T	A	2: 69,795,979	F160I	probably damaging	Het
Plch2	T	G	4: 155,007,083	D115A	probably damaging	Het
Plekho1	A	G	3: 95,989,539	F215S	probably damaging	Het
Psma4	C	A	9: 54,952,772	A47E	probably damaging	Het
Rasa4	A	C	5: 136,101,299	Q303P	probably damaging	Het
Rbmxl2	C	T	7: 107,210,207	P233L	probably damaging	Het
Reln	A	T	5: 22,034,638	L877H	probably damaging	Het
Rtel1	A	G	2: 181,322,514		probably null	Het
Sept12	T	C	16: 4,993,756	D116G	probably damaging	Het
Son	T	A	16: 91,656,375	V670E	probably damaging	Het
Spag9	T	A	11: 94,097,786	I544N	probably benign	Het
Spsb3	T	G	17: 24,887,062		probably benign	Het
Tgfbr3	T	C	5: 107,214,970	T59A	probably damaging	Het
Tsc1	T	A	2: 28,676,519	I649K	probably damaging	Het
Txndc9	T	C	1: 37,995,712	D37G	probably benign	Het
Uba7	C	T	9: 107,978,914	A496V	probably benign	Het
Usf3	T	A	16: 44,215,526	I123N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,530	S234T	possibly damaging	Het
Vsig10l	C	A	7: 43,465,317	S314*	probably null	Het
Wdfy4	A	G	14: 33,079,935	F1922S	probably damaging	Het
Zfp219	C	T	14: 52,009,655	R5H	probably damaging	Het
Zfp946	G	T	17: 22,455,603	C446F	probably benign	Het

Other mutations in Nbas

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00486:Nbas	APN	12	13453075	missense	probably benign	0.19
IGL00712:Nbas	APN	12	13362625	splice site	probably benign
IGL00808:Nbas	APN	12	13566120	splice site	probably benign
IGL00915:Nbas	APN	12	13374752	nonsense	probably null
IGL00923:Nbas	APN	12	13336284	missense	possibly damaging	0.46
IGL01152:Nbas	APN	12	13360958	missense	probably damaging	1.00
IGL01633:Nbas	APN	12	13483897	missense	probably damaging	1.00
IGL01672:Nbas	APN	12	13379649	missense	possibly damaging	0.63
IGL01799:Nbas	APN	12	13324400	splice site	probably benign
IGL01812:Nbas	APN	12	13453503	missense	probably damaging	1.00
IGL01934:Nbas	APN	12	13289879	splice site	probably benign
IGL02093:Nbas	APN	12	13560962	missense	probably benign	0.00
IGL02115:Nbas	APN	12	13317692	splice site	probably benign
IGL02175:Nbas	APN	12	13566259	critical splice donor site	probably null
IGL02268:Nbas	APN	12	13405397	missense	possibly damaging	0.94
IGL02483:Nbas	APN	12	13324294	missense	probably damaging	1.00
IGL02539:Nbas	APN	12	13272703	splice site	probably benign
IGL02557:Nbas	APN	12	13361028	missense	probably damaging	1.00
IGL02815:Nbas	APN	12	13310266	missense	probably damaging	1.00
IGL02951:Nbas	APN	12	13362541	missense	probably benign
IGL03131:Nbas	APN	12	13279416	missense	probably benign	0.03
IGL03214:Nbas	APN	12	13331110	splice site	probably benign
IGL03308:Nbas	APN	12	13324348	missense	possibly damaging	0.93
IGL03368:Nbas	APN	12	13328451	missense	probably benign	0.08
IGL03372:Nbas	APN	12	13534472	missense	probably damaging	1.00
IGL03391:Nbas	APN	12	13483749	missense	probably benign	0.28
medvedev	UTSW	12	13534577	critical splice donor site	probably null
oligarchs	UTSW	12	13520750	missense	possibly damaging	0.75
putin	UTSW	12	13321755	missense	probably damaging	1.00
1mM(1):Nbas	UTSW	12	13288728	missense	probably damaging	1.00
R0057:Nbas	UTSW	12	13390957	missense	probably benign	0.00
R0076:Nbas	UTSW	12	13324336	missense	probably damaging	1.00
R0153:Nbas	UTSW	12	13273876	splice site	probably benign
R0371:Nbas	UTSW	12	13331095	missense	probably damaging	0.97
R0449:Nbas	UTSW	12	13519108	missense	probably benign	0.18
R0791:Nbas	UTSW	12	13482633	missense	probably benign	0.28
R0931:Nbas	UTSW	12	13331114	splice site	probably benign
R1236:Nbas	UTSW	12	13269241	missense	probably damaging	1.00
R1371:Nbas	UTSW	12	13482378	splice site	probably benign
R1567:Nbas	UTSW	12	13285278	missense	possibly damaging	0.70
R1587:Nbas	UTSW	12	13558685	missense	probably benign
R1719:Nbas	UTSW	12	13560977	critical splice donor site	probably null
R1747:Nbas	UTSW	12	13335898	missense	probably benign	0.00
R1777:Nbas	UTSW	12	13513562	missense	probably benign	0.16
R1848:Nbas	UTSW	12	13413597	missense	probably damaging	0.97
R1856:Nbas	UTSW	12	13474229	missense	possibly damaging	0.56
R1891:Nbas	UTSW	12	13390972	missense	possibly damaging	0.92
R1911:Nbas	UTSW	12	13566144	missense	probably benign
R1912:Nbas	UTSW	12	13566144	missense	probably benign
R2006:Nbas	UTSW	12	13414741	intron	probably null
R2054:Nbas	UTSW	12	13474206	missense	probably benign	0.36
R2065:Nbas	UTSW	12	13566157	missense	probably damaging	1.00
R2089:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2091:Nbas	UTSW	12	13361045	missense	probably benign	0.03
R2156:Nbas	UTSW	12	13441509	missense	probably damaging	1.00
R2164:Nbas	UTSW	12	13330646	missense	possibly damaging	0.74
R2339:Nbas	UTSW	12	13362592	missense	probably benign	0.12
R2398:Nbas	UTSW	12	13432945	missense	probably damaging	0.99
R3806:Nbas	UTSW	12	13482504	missense	probably damaging	1.00
R3855:Nbas	UTSW	12	13279414	missense	possibly damaging	0.50
R4019:Nbas	UTSW	12	13482519	missense	probably damaging	1.00
R4083:Nbas	UTSW	12	13474191	missense	probably damaging	0.96
R4201:Nbas	UTSW	12	13374826	missense	probably benign	0.00
R4231:Nbas	UTSW	12	13393343	missense	probably damaging	0.98
R4552:Nbas	UTSW	12	13335937	critical splice donor site	probably null
R4560:Nbas	UTSW	12	13583527	missense	probably benign	0.00
R4728:Nbas	UTSW	12	13288739	missense	probably damaging	0.98
R4752:Nbas	UTSW	12	13482537	missense	possibly damaging	0.92
R4832:Nbas	UTSW	12	13483739	missense	probably benign	0.00
R4874:Nbas	UTSW	12	13321755	missense	probably damaging	1.00
R4988:Nbas	UTSW	12	13408265	missense	probably benign	0.45
R5079:Nbas	UTSW	12	13374711	missense	probably damaging	1.00
R5129:Nbas	UTSW	12	13390960	missense	probably damaging	1.00
R5239:Nbas	UTSW	12	13441518	missense	probably benign	0.31
R5299:Nbas	UTSW	12	13441925	nonsense	probably null
R5351:Nbas	UTSW	12	13560849	missense	probably damaging	1.00
R5389:Nbas	UTSW	12	13534577	critical splice donor site	probably null
R5436:Nbas	UTSW	12	13374811	missense	probably damaging	1.00
R5654:Nbas	UTSW	12	13583475	missense	probably damaging	1.00
R5690:Nbas	UTSW	12	13336284	missense	probably damaging	1.00
R5842:Nbas	UTSW	12	13269266	critical splice donor site	probably null
R5959:Nbas	UTSW	12	13288801	missense	probably damaging	0.99
R5982:Nbas	UTSW	12	13393430	missense	probably benign	0.00
R6238:Nbas	UTSW	12	13482595	missense	probably benign
R6270:Nbas	UTSW	12	13324293	missense	probably damaging	1.00
R6363:Nbas	UTSW	12	13482576	missense	probably benign
R6424:Nbas	UTSW	12	13415733	critical splice donor site	probably null
R6458:Nbas	UTSW	12	13288749	missense	probably damaging	1.00
R6526:Nbas	UTSW	12	13405425	missense	probably damaging	1.00
R6654:Nbas	UTSW	12	13483874	nonsense	probably null
R7085:Nbas	UTSW	12	13285258	missense	probably damaging	1.00
R7179:Nbas	UTSW	12	13405397	missense	possibly damaging	0.94
R7197:Nbas	UTSW	12	13520750	missense	possibly damaging	0.75
R7378:Nbas	UTSW	12	13274219	missense	probably damaging	1.00
R7393:Nbas	UTSW	12	13393492	missense	probably damaging	1.00
R7425:Nbas	UTSW	12	13469880	missense	probably damaging	1.00
R7446:Nbas	UTSW	12	13393498	missense	probably benign	0.02
R7481:Nbas	UTSW	12	13356959	missense	probably damaging	0.97
R7535:Nbas	UTSW	12	13279389	missense	probably damaging	0.97
R7626:Nbas	UTSW	12	13558660	missense	probably benign	0.00
R7678:Nbas	UTSW	12	13415661	missense	probably damaging	0.97
R7912:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R7993:Nbas	UTSW	12	13405457	missense	possibly damaging	0.91
R8193:Nbas	UTSW	12	13433009	missense	probably damaging	1.00
RF013:Nbas	UTSW	12	13279408	missense	possibly damaging	0.54
T0722:Nbas	UTSW	12	13352808	missense	probably benign	0.00
Z1176:Nbas	UTSW	12	13483876	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GGCCATAAATTGAAGAGTCCG -3'
(R):5'- ACACTTAGAAAAGCAGTGCCTTTC -3'

Sequencing Primer
(F):5'- GAGTCCGATTTTAGTAGATGAAGC -3'
(R):5'- GAAAAGCAGTGCCTTTCTTTTAC -3'

Posted On

2016-06-06