Incidental Mutation 'R5020:Nedd9'
ID389161
Institutional Source Beutler Lab
Gene Symbol Nedd9
Ensembl Gene ENSMUSG00000021365
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 9
SynonymsE230025G09Rik, HEF1, Cas-L, CasL
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41309581-41487362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41315794 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 628 (Y628H)
Ref Sequence ENSEMBL: ENSMUSP00000125773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021794] [ENSMUST00000163623] [ENSMUST00000224803]
Predicted Effect probably damaging
Transcript: ENSMUST00000021794
AA Change: Y628H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021794
Gene: ENSMUSG00000021365
AA Change: Y628H

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.33e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 561 3.2e-66 PFAM
Pfam:DUF3513 611 828 1.4e-91 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163623
AA Change: Y628H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125773
Gene: ENSMUSG00000021365
AA Change: Y628H

DomainStartEndE-ValueType
SH3 6 64 3.78e-17 SMART
internal_repeat_1 151 218 1.42e-7 PROSPERO
low complexity region 368 396 N/A INTRINSIC
Pfam:Serine_rich 403 559 2.7e-60 PFAM
Pfam:DUF3513 618 827 1e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224803
Meta Mutation Damage Score 0.3823 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the CRK-associated substrates family. Members of this family are adhesion docking molecules that mediate protein-protein interactions for signal transduction pathways. This protein is a focal adhesion protein that acts as a scaffold to regulate signaling complexes important in cell attachment, migration and invasion as well as apoptosis and the cell cycle. This protein has also been reported to have a role in cancer metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for one null allele exhibit impaired lymphocyte trafficking and a deficit of splenic marginal zone B cells. Mice homozygous for another null allele display impaired spatial learning and decreased hippocampal dendritic spine densities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Nedd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Nedd9 APN 13 41316234 missense probably benign 0.00
IGL01412:Nedd9 APN 13 41315786 nonsense probably null
IGL01669:Nedd9 APN 13 41338635 missense probably damaging 0.99
IGL02543:Nedd9 APN 13 41316735 missense probably damaging 1.00
IGL03302:Nedd9 APN 13 41338854 missense probably damaging 0.99
hebei UTSW 13 41338979 nonsense probably null
sheep UTSW 13 41317962 missense probably benign 0.33
yanzhao UTSW 13 41311794 missense probably damaging 1.00
R1157:Nedd9 UTSW 13 41314503 intron probably null
R1611:Nedd9 UTSW 13 41316930 missense probably benign
R1669:Nedd9 UTSW 13 41311794 missense probably damaging 1.00
R1718:Nedd9 UTSW 13 41338926 missense probably damaging 1.00
R1775:Nedd9 UTSW 13 41317962 missense probably benign 0.33
R1971:Nedd9 UTSW 13 41338948 missense probably damaging 1.00
R2107:Nedd9 UTSW 13 41338979 nonsense probably null
R2341:Nedd9 UTSW 13 41316511 missense probably damaging 1.00
R4362:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4363:Nedd9 UTSW 13 41317953 missense probably damaging 0.99
R4707:Nedd9 UTSW 13 41338575 critical splice donor site probably null
R4724:Nedd9 UTSW 13 41316597 missense possibly damaging 0.50
R4795:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4796:Nedd9 UTSW 13 41317900 missense probably benign 0.12
R4853:Nedd9 UTSW 13 41316361 missense probably benign 0.01
R4934:Nedd9 UTSW 13 41338935 missense probably damaging 1.00
R5070:Nedd9 UTSW 13 41316598 missense probably benign 0.00
R5585:Nedd9 UTSW 13 41316474 missense probably damaging 1.00
R5588:Nedd9 UTSW 13 41315961 missense possibly damaging 0.76
R6310:Nedd9 UTSW 13 41318452 missense probably benign 0.00
R6634:Nedd9 UTSW 13 41312108 missense probably damaging 1.00
R6729:Nedd9 UTSW 13 41315802 missense probably damaging 0.99
R7114:Nedd9 UTSW 13 41338623 missense probably benign
R7172:Nedd9 UTSW 13 41316804 missense probably benign 0.01
R7477:Nedd9 UTSW 13 41318480 missense probably benign 0.02
R7665:Nedd9 UTSW 13 41316309 missense probably benign 0.01
R7672:Nedd9 UTSW 13 41338722 missense possibly damaging 0.69
R7810:Nedd9 UTSW 13 41312007 missense possibly damaging 0.52
R7893:Nedd9 UTSW 13 41315789 missense probably damaging 1.00
R8215:Nedd9 UTSW 13 41338843 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTGGACAACCTCACCCTCAG -3'
(R):5'- GGAGACCCTCTTTAGAGCAGATC -3'

Sequencing Primer
(F):5'- ACCCTCAGTTTTCACAACAGTTAG -3'
(R):5'- TTCCCATCTGAAGAATGGGC -3'
Posted On2016-06-06