Incidental Mutation 'R5020:Zfp219'
List |< first << previous [record 63 of 64] next >> last >|
ID389165
Institutional Source Beutler Lab
Gene Symbol Zfp219
Ensembl Gene ENSMUSG00000049295
Gene Namezinc finger protein 219
Synonyms2010302A17Rik
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5020 (G1)
Quality Score188
Status Validated
Chromosome14
Chromosomal Location52006077-52020733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 52009655 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 5 (R5H)
Ref Sequence ENSEMBL: ENSMUSP00000154768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067549] [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000166169] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000228162] [ENSMUST00000226605] [ENSMUST00000226554] [ENSMUST00000226964] [ENSMUST00000226527] [ENSMUST00000228051] [ENSMUST00000228747] [ENSMUST00000226522] [ENSMUST00000182909] [ENSMUST00000182905] [ENSMUST00000228580] [ENSMUST00000183208]
Predicted Effect probably damaging
Transcript: ENSMUST00000067549
AA Change: R5H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068184
Gene: ENSMUSG00000049295
AA Change: R5H

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093813
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100639
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166169
AA Change: R5H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126854
Gene: ENSMUSG00000049295
AA Change: R5H

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
ZnF_C2H2 61 83 6.23e-2 SMART
ZnF_C2H2 89 111 4.17e-3 SMART
low complexity region 113 146 N/A INTRINSIC
ZnF_C2H2 167 190 3.07e-1 SMART
ZnF_C2H2 193 216 1.51e0 SMART
low complexity region 229 276 N/A INTRINSIC
ZnF_C2H2 277 299 8.47e-4 SMART
ZnF_C2H2 305 327 1.38e-3 SMART
low complexity region 331 350 N/A INTRINSIC
low complexity region 354 379 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
ZnF_C2H2 501 523 3.63e-3 SMART
ZnF_C2H2 529 551 1.58e-3 SMART
low complexity region 560 570 N/A INTRINSIC
low complexity region 594 611 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
ZnF_C2H2 650 672 2.82e0 SMART
low complexity region 675 684 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182061
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect probably benign
Transcript: ENSMUST00000182667
Predicted Effect probably benign
Transcript: ENSMUST00000182760
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182777
Predicted Effect probably benign
Transcript: ENSMUST00000182828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183213
Predicted Effect unknown
Transcript: ENSMUST00000228162
AA Change: R5H
Predicted Effect probably damaging
Transcript: ENSMUST00000226605
AA Change: R5H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000226554
AA Change: R5H
Predicted Effect probably damaging
Transcript: ENSMUST00000226964
AA Change: R5H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226527
AA Change: R5H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228051
AA Change: R5H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228747
AA Change: R5H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226522
AA Change: R5H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000182909
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182905
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226474
Predicted Effect probably benign
Transcript: ENSMUST00000228580
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Zfp219
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Zfp219 APN 14 52009301 missense probably damaging 1.00
Bart UTSW 14 52006706 missense probably damaging 0.99
Bert UTSW 14 52006938 missense probably benign 0.02
R0019:Zfp219 UTSW 14 52009028 missense probably damaging 1.00
R0103:Zfp219 UTSW 14 52006706 missense probably damaging 0.99
R0811:Zfp219 UTSW 14 52006938 missense probably benign 0.02
R0812:Zfp219 UTSW 14 52006938 missense probably benign 0.02
R1677:Zfp219 UTSW 14 52009055 missense probably damaging 1.00
R1773:Zfp219 UTSW 14 52007106 missense probably damaging 0.99
R1921:Zfp219 UTSW 14 52008234 missense probably benign 0.00
R2929:Zfp219 UTSW 14 52008979 missense probably benign 0.00
R3970:Zfp219 UTSW 14 52006964 missense probably benign 0.05
R4485:Zfp219 UTSW 14 52007384 missense probably damaging 0.99
R5206:Zfp219 UTSW 14 52009565 missense probably benign 0.40
R5244:Zfp219 UTSW 14 52008542 missense possibly damaging 0.64
R5907:Zfp219 UTSW 14 52007149 critical splice acceptor site probably null
R6903:Zfp219 UTSW 14 52006661 missense probably benign 0.31
R7409:Zfp219 UTSW 14 52007113 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCGCACACAGGACAAGG -3'
(R):5'- TACGTTATTAACTTGGCCCCG -3'

Sequencing Primer
(F):5'- ACAAGGGAAGCGCCGTTC -3'
(R):5'- ATTAACTTGGCCCCGGTGTC -3'
Posted On2016-06-06