Incidental Mutation 'R5020:Sept12'
ID389167
Institutional Source Beutler Lab
Gene Symbol Sept12
Ensembl Gene ENSMUSG00000022542
Gene Nameseptin 12
SynonymsSeptin12, 1700028G04Rik, 4933413B09Rik
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4986858-4997852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4993756 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 116 (D116G)
Ref Sequence ENSEMBL: ENSMUSP00000154901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170323] [ENSMUST00000229321] [ENSMUST00000230362]
Predicted Effect probably damaging
Transcript: ENSMUST00000170323
AA Change: D116G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131062
Gene: ENSMUSG00000022542
AA Change: D116G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:Septin 44 277 1.4e-85 PFAM
Pfam:MMR_HSR1 49 248 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229321
AA Change: D116G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000230362
AA Change: D116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230878
Meta Mutation Damage Score 0.8715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Chimeric male mice are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arhgap31 T C 16: 38,603,076 D876G probably damaging Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Sept12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1521:Sept12 UTSW 16 4996476 missense probably damaging 1.00
R1542:Sept12 UTSW 16 4992295 missense probably benign 0.02
R1618:Sept12 UTSW 16 4996476 missense probably damaging 1.00
R1690:Sept12 UTSW 16 4988514 missense probably damaging 1.00
R1912:Sept12 UTSW 16 4988553 missense probably damaging 1.00
R2131:Sept12 UTSW 16 4991779 missense probably damaging 1.00
R2138:Sept12 UTSW 16 4992206 missense probably damaging 1.00
R4673:Sept12 UTSW 16 4991943 missense probably damaging 1.00
R5328:Sept12 UTSW 16 4993993 missense possibly damaging 0.96
R6063:Sept12 UTSW 16 4992263 missense probably damaging 1.00
R7104:Sept12 UTSW 16 4991993 missense probably damaging 1.00
R7142:Sept12 UTSW 16 4988362 missense unknown
R7317:Sept12 UTSW 16 4991735 missense probably damaging 0.98
R7382:Sept12 UTSW 16 4988482 missense probably damaging 1.00
R7560:Sept12 UTSW 16 4992191 missense possibly damaging 0.91
R7631:Sept12 UTSW 16 4996456 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCACCAACTCTGTACTAGCTAG -3'
(R):5'- CAAAGTATGGCAGTCAACTGAAC -3'

Sequencing Primer
(F):5'- CTGTACTAGCTAGATTGCTGAGACC -3'
(R):5'- ACCTGGATGTACCCATGCC -3'
Posted On2016-06-06