Incidental Mutation 'R5020:Arhgap31'
List |< first << previous [record 7 of 64] next >> last >|
ID389168
Institutional Source Beutler Lab
Gene Symbol Arhgap31
Ensembl Gene ENSMUSG00000022799
Gene NameRho GTPase activating protein 31
SynonymsCdGAP
MMRRC Submission 042611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5020 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38598340-38713274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38603076 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 876 (D876G)
Ref Sequence ENSEMBL: ENSMUSP00000023487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023487]
Predicted Effect probably damaging
Transcript: ENSMUST00000023487
AA Change: D876G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023487
Gene: ENSMUSG00000022799
AA Change: D876G

DomainStartEndE-ValueType
RhoGAP 32 213 1.04e-60 SMART
low complexity region 291 303 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
low complexity region 722 733 N/A INTRINSIC
low complexity region 766 786 N/A INTRINSIC
Meta Mutation Damage Score 0.1496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP). A variety of cellular processes are regulated by Rho GTPases which cycle between an inactive form bound to GDP and an active form bound to GTP. This cycling between inactive and active forms is regulated by guanine nucleotide exchange factors and GAPs. The encoded protein is a GAP shown to regulate two GTPases involved in protein trafficking and cell growth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,282,502 D70G probably benign Het
Acadsb A T 7: 131,441,200 probably null Het
Actl6a A G 3: 32,720,507 I340V possibly damaging Het
Alppl2 C T 1: 87,089,709 V19I probably benign Het
Ankrd34c T C 9: 89,729,706 K194R probably benign Het
Anpep T A 7: 79,833,727 M672L probably benign Het
Arid2 T A 15: 96,371,988 N1327K probably damaging Het
Atp5d C A 10: 80,145,429 P101Q probably benign Het
Bcl7b G A 5: 135,171,163 probably null Het
Brca2 A T 5: 150,560,436 S2907C probably damaging Het
Ccser2 T C 14: 36,940,177 E350G probably benign Het
Cdh23 G T 10: 60,308,032 D2929E probably damaging Het
Clec2i T A 6: 128,893,658 V78E probably benign Het
Cpxm1 A T 2: 130,395,977 probably null Het
Crybg3 C T 16: 59,554,796 V2032I possibly damaging Het
Eif5b A T 1: 38,019,069 K151* probably null Het
Gemin7 T A 7: 19,565,423 E82D possibly damaging Het
Gm14496 A G 2: 181,991,359 E45G possibly damaging Het
Gm20767 T C 13: 120,155,116 F164L possibly damaging Het
Gm21915 T C 9: 40,670,670 S20P probably damaging Het
Gm8126 A C 14: 43,261,569 E165A probably damaging Het
Grin2b T C 6: 135,733,407 D1047G probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Ikbke T A 1: 131,273,660 Y150F probably damaging Het
Itih5 T A 2: 10,240,504 probably null Het
Lrig2 T C 3: 104,457,901 Q645R possibly damaging Het
Map4 A G 9: 110,068,800 M712V probably benign Het
Mecom A G 3: 29,961,106 S823P probably damaging Het
Mettl25 A G 10: 105,826,207 Y301H possibly damaging Het
Mga A T 2: 119,951,173 K2136* probably null Het
Mmp24 A G 2: 155,810,284 E304G probably benign Het
Mmp3 T A 9: 7,445,984 D29E probably benign Het
Nbas T A 12: 13,374,712 I984N probably damaging Het
Nedd9 A G 13: 41,315,794 Y628H probably damaging Het
Nlrp2 C T 7: 5,328,077 C440Y probably damaging Het
Olfr1279 T C 2: 111,306,292 V29A probably benign Het
Olfr414 T G 1: 174,430,671 L81R probably damaging Het
P4ha2 T C 11: 54,131,190 V513A probably damaging Het
Pcsk4 T C 10: 80,326,035 N124S probably benign Het
Phf12 T C 11: 78,023,796 F139S probably damaging Het
Phlpp2 T A 8: 109,940,082 L1081H probably damaging Het
Phospho2 T A 2: 69,795,979 F160I probably damaging Het
Plch2 T G 4: 155,007,083 D115A probably damaging Het
Plekho1 A G 3: 95,989,539 F215S probably damaging Het
Psma4 C A 9: 54,952,772 A47E probably damaging Het
Rasa4 A C 5: 136,101,299 Q303P probably damaging Het
Rbmxl2 C T 7: 107,210,207 P233L probably damaging Het
Reln A T 5: 22,034,638 L877H probably damaging Het
Rtel1 A G 2: 181,322,514 probably null Het
Sept12 T C 16: 4,993,756 D116G probably damaging Het
Son T A 16: 91,656,375 V670E probably damaging Het
Spag9 T A 11: 94,097,786 I544N probably benign Het
Spsb3 T G 17: 24,887,062 probably benign Het
Tgfbr3 T C 5: 107,214,970 T59A probably damaging Het
Tsc1 T A 2: 28,676,519 I649K probably damaging Het
Txndc9 T C 1: 37,995,712 D37G probably benign Het
Uba7 C T 9: 107,978,914 A496V probably benign Het
Usf3 T A 16: 44,215,526 I123N probably damaging Het
Vmn1r184 T A 7: 26,267,530 S234T possibly damaging Het
Vsig10l C A 7: 43,465,317 S314* probably null Het
Wdfy4 A G 14: 33,079,935 F1922S probably damaging Het
Zfp219 C T 14: 52,009,655 R5H probably damaging Het
Zfp946 G T 17: 22,455,603 C446F probably benign Het
Other mutations in Arhgap31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:Arhgap31 APN 16 38603001 missense probably damaging 1.00
IGL01062:Arhgap31 APN 16 38601456 missense probably damaging 1.00
IGL01152:Arhgap31 APN 16 38602239 missense possibly damaging 0.49
IGL01680:Arhgap31 APN 16 38603614 missense probably benign 0.04
IGL01739:Arhgap31 APN 16 38603431 missense probably benign
IGL01870:Arhgap31 APN 16 38618242 missense probably damaging 1.00
IGL01936:Arhgap31 APN 16 38602925 missense probably damaging 1.00
IGL01981:Arhgap31 APN 16 38601573 missense probably damaging 1.00
IGL01983:Arhgap31 APN 16 38601765 missense probably damaging 1.00
IGL02157:Arhgap31 APN 16 38623901 missense probably damaging 1.00
IGL02629:Arhgap31 APN 16 38609164 missense probably benign 0.00
IGL03375:Arhgap31 APN 16 38602828 missense probably damaging 1.00
PIT4283001:Arhgap31 UTSW 16 38608992 missense probably damaging 1.00
R0271:Arhgap31 UTSW 16 38602510 missense possibly damaging 0.61
R1325:Arhgap31 UTSW 16 38602942 missense probably benign 0.00
R1753:Arhgap31 UTSW 16 38601612 missense possibly damaging 0.92
R1766:Arhgap31 UTSW 16 38625590 missense probably damaging 1.00
R1834:Arhgap31 UTSW 16 38603703 missense probably benign 0.02
R2104:Arhgap31 UTSW 16 38625579 missense probably benign 0.03
R2261:Arhgap31 UTSW 16 38609277 missense probably damaging 1.00
R3011:Arhgap31 UTSW 16 38601907 missense possibly damaging 0.58
R3712:Arhgap31 UTSW 16 38602533 missense possibly damaging 0.91
R3757:Arhgap31 UTSW 16 38637000 missense probably damaging 1.00
R3953:Arhgap31 UTSW 16 38603464 missense probably benign 0.00
R4105:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4107:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4108:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4109:Arhgap31 UTSW 16 38602426 missense probably damaging 1.00
R4198:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4200:Arhgap31 UTSW 16 38623913 missense probably damaging 1.00
R4273:Arhgap31 UTSW 16 38602335 missense possibly damaging 0.92
R5100:Arhgap31 UTSW 16 38601459 missense probably damaging 1.00
R6516:Arhgap31 UTSW 16 38609404 missense possibly damaging 0.47
R6879:Arhgap31 UTSW 16 38602314 missense probably benign
R7341:Arhgap31 UTSW 16 38712514 intron probably null
R7880:Arhgap31 UTSW 16 38602725 missense probably benign 0.37
R7884:Arhgap31 UTSW 16 38602231 missense probably damaging 0.97
R8156:Arhgap31 UTSW 16 38625629 missense probably damaging 1.00
R8223:Arhgap31 UTSW 16 38603722 missense probably benign 0.21
X0063:Arhgap31 UTSW 16 38602398 missense probably damaging 0.99
Z1176:Arhgap31 UTSW 16 38623893 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGCAAAGTCTCCTCTCTAATC -3'
(R):5'- GGGATTCCAGGACAGATGTC -3'

Sequencing Primer
(F):5'- GCAAAGTCTCCTCTCTAATCGGTGG -3'
(R):5'- GGATTCCAGGACAGATGTCTACAC -3'
Posted On2016-06-06