Incidental Mutation 'R5021:Schip1'
ID389180
Institutional Source Beutler Lab
Gene Symbol Schip1
Ensembl Gene ENSMUSG00000027777
Gene Nameschwannomin interacting protein 1
SynonymsSCHIP-1
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R5021 (G1)
Quality Score197
Status Validated
Chromosome3
Chromosomal Location68064802-68626481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68495252 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 221 (T221A)
Ref Sequence ENSEMBL: ENSMUSP00000138207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029346] [ENSMUST00000169909] [ENSMUST00000182006] [ENSMUST00000182532] [ENSMUST00000182719] [ENSMUST00000192555]
Predicted Effect probably benign
Transcript: ENSMUST00000029346
AA Change: T249A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029346
Gene: ENSMUSG00000027777
AA Change: T249A

DomainStartEndE-ValueType
low complexity region 33 49 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 95 113 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
low complexity region 186 198 N/A INTRINSIC
Pfam:SCHIP-1 252 481 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169909
SMART Domains Protein: ENSMUSP00000129152
Gene: ENSMUSG00000027777

DomainStartEndE-ValueType
Pfam:SCHIP-1 20 256 4.3e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182006
AA Change: T324A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138212
Gene: ENSMUSG00000102422
AA Change: T324A

DomainStartEndE-ValueType
Pfam:IQ-like 1 97 1e-54 PFAM
low complexity region 108 124 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 261 273 N/A INTRINSIC
Pfam:SCHIP-1 323 559 9.8e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182532
AA Change: T221A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138245
Gene: ENSMUSG00000027777
AA Change: T221A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182719
AA Change: T221A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138207
Gene: ENSMUSG00000027777
AA Change: T221A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192555
AA Change: T221A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142090
Gene: ENSMUSG00000027777
AA Change: T221A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 388 1.1e-103 PFAM
Meta Mutation Damage Score 0.0675 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects and defective cell mirgration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Schip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Schip1 APN 3 68617777 missense probably damaging 1.00
IGL03354:Schip1 APN 3 68494965 missense possibly damaging 0.94
R0190:Schip1 UTSW 3 68625844 missense probably benign 0.09
R0413:Schip1 UTSW 3 68494613 missense probably damaging 1.00
R1256:Schip1 UTSW 3 68495042 missense probably benign 0.12
R1777:Schip1 UTSW 3 68617684 missense probably damaging 1.00
R2067:Schip1 UTSW 3 68617786 missense probably damaging 1.00
R3027:Schip1 UTSW 3 68494610 missense probably damaging 1.00
R4258:Schip1 UTSW 3 68618630 missense possibly damaging 0.88
R4646:Schip1 UTSW 3 68064964 missense probably benign
R4917:Schip1 UTSW 3 68408485 intron probably benign
R4918:Schip1 UTSW 3 68408485 intron probably benign
R5194:Schip1 UTSW 3 68494872 missense probably benign 0.15
R5225:Schip1 UTSW 3 68494937 missense probably benign
R5719:Schip1 UTSW 3 68408227 intron probably benign
R6460:Schip1 UTSW 3 68494894 missense probably benign 0.37
R7189:Schip1 UTSW 3 68617699 missense probably damaging 1.00
R7189:Schip1 UTSW 3 68617700 missense probably damaging 1.00
R7727:Schip1 UTSW 3 68064984
Predicted Primers PCR Primer
(F):5'- AATGGCAACGTGGTGGTAGC -3'
(R):5'- CAAAATGAGTCGCGGGTTC -3'

Sequencing Primer
(F):5'- AACGTGGTGGTAGCTGGCC -3'
(R):5'- AAAATGAGTCGCGGGTTCCTCTAG -3'
Posted On2016-06-06