Incidental Mutation 'R5021:Clcn1'
ID389187
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5021 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 42310988 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 718 (K718*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably benign
Transcript: ENSMUST00000031891
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031894
AA Change: K790*
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: K790*

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095974
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143278
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163235
AA Change: K78*
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862
AA Change: K78*

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163936
AA Change: K718*
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: K718*

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169902
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTGTCCTAGGGAGCTG -3'
(R):5'- TCTTCTCAGGTTAGTAATGGTTCTCAG -3'

Sequencing Primer
(F):5'- TGGGACAGAGGTAGAAAAGAGGAAAC -3'
(R):5'- AGAAACTATGTCCTCCTGGGTCG -3'
Posted On2016-06-06