Incidental Mutation 'R5021:Zfp777'
ID389188
Institutional Source Beutler Lab
Gene Symbol Zfp777
Ensembl Gene ENSMUSG00000071477
Gene Namezinc finger protein 777
Synonyms
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R5021 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48024188-48048911 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48042127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000093637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095944] [ENSMUST00000114583] [ENSMUST00000125385] [ENSMUST00000147281]
Predicted Effect probably damaging
Transcript: ENSMUST00000095944
AA Change: V291A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093637
Gene: ENSMUSG00000071477
AA Change: V291A

DomainStartEndE-ValueType
Pfam:DUF3669 177 256 4.3e-12 PFAM
KRAB 284 344 1.6e-29 SMART
low complexity region 422 433 N/A INTRINSIC
coiled coil region 454 477 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 520 532 N/A INTRINSIC
low complexity region 539 555 N/A INTRINSIC
ZnF_C2H2 557 579 1.2e-5 SMART
ZnF_C2H2 585 607 3.8e-5 SMART
ZnF_C2H2 646 668 1.1e-6 SMART
ZnF_C2H2 674 696 4.6e-6 SMART
ZnF_C2H2 704 726 3.2e-7 SMART
ZnF_C2H2 732 754 3.3e-6 SMART
ZnF_C2H2 760 782 8.4e-6 SMART
ZnF_C2H2 788 810 4.9e-5 SMART
ZnF_C2H2 816 838 1.1e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114583
AA Change: V335A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110230
Gene: ENSMUSG00000071477
AA Change: V335A

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:DUF3669 231 298 4.7e-12 PFAM
KRAB 328 388 3.96e-27 SMART
low complexity region 466 477 N/A INTRINSIC
coiled coil region 498 521 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
low complexity region 583 599 N/A INTRINSIC
ZnF_C2H2 601 623 2.95e-3 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 690 712 2.43e-4 SMART
ZnF_C2H2 718 740 1.12e-3 SMART
ZnF_C2H2 748 770 7.49e-5 SMART
ZnF_C2H2 776 798 7.9e-4 SMART
ZnF_C2H2 804 826 1.95e-3 SMART
ZnF_C2H2 832 854 1.18e-2 SMART
ZnF_C2H2 860 882 2.53e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125385
Predicted Effect probably benign
Transcript: ENSMUST00000147281
Predicted Effect possibly damaging
Transcript: ENSMUST00000148362
AA Change: V143A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116303
Gene: ENSMUSG00000071477
AA Change: V143A

DomainStartEndE-ValueType
Pfam:DUF3669 40 107 6.1e-13 PFAM
KRAB 137 197 3.96e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203645
Meta Mutation Damage Score 0.4882 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Other mutations in Zfp777
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Zfp777 APN 6 48043984 missense probably damaging 1.00
IGL01916:Zfp777 APN 6 48025342 missense probably damaging 1.00
IGL01959:Zfp777 APN 6 48044341 missense probably benign
IGL02167:Zfp777 APN 6 48044526 missense probably damaging 0.98
IGL03150:Zfp777 APN 6 48044125 missense probably damaging 1.00
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0238:Zfp777 UTSW 6 48024969 missense probably damaging 0.99
R0372:Zfp777 UTSW 6 48044476 missense possibly damaging 0.62
R0762:Zfp777 UTSW 6 48029360 missense probably damaging 1.00
R1300:Zfp777 UTSW 6 48025770 missense probably benign 0.43
R1727:Zfp777 UTSW 6 48043890 missense probably damaging 0.99
R1906:Zfp777 UTSW 6 48042061 missense probably damaging 0.99
R2047:Zfp777 UTSW 6 48044346 missense probably benign
R2097:Zfp777 UTSW 6 48044242 missense probably benign 0.08
R2211:Zfp777 UTSW 6 48043885 missense possibly damaging 0.79
R2898:Zfp777 UTSW 6 48025660 missense probably damaging 0.97
R3123:Zfp777 UTSW 6 48029116 unclassified probably benign
R3832:Zfp777 UTSW 6 48044215 missense probably benign 0.00
R4019:Zfp777 UTSW 6 48042112 missense probably damaging 1.00
R4077:Zfp777 UTSW 6 48025522 missense probably benign
R4471:Zfp777 UTSW 6 48042107 missense probably damaging 1.00
R5030:Zfp777 UTSW 6 48037667 missense probably damaging 0.99
R5819:Zfp777 UTSW 6 48037588 missense probably damaging 0.99
R6544:Zfp777 UTSW 6 48044485 missense probably damaging 0.98
R6736:Zfp777 UTSW 6 48024856 missense probably damaging 0.99
R6971:Zfp777 UTSW 6 48024691 missense probably damaging 1.00
R7240:Zfp777 UTSW 6 48044449 missense probably benign 0.00
R7258:Zfp777 UTSW 6 48025797 missense probably damaging 0.99
R7586:Zfp777 UTSW 6 48029218 missense probably benign 0.33
R7833:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
R7916:Zfp777 UTSW 6 48025138 missense probably damaging 0.99
RF008:Zfp777 UTSW 6 48042048 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCAATACAGGAGCTGCTGTTC -3'
(R):5'- AGGCAAGATGAGTCCTCCAC -3'

Sequencing Primer
(F):5'- ATACAGGAGCTGCTGTTCACATTTC -3'
(R):5'- GCAGAATGTTGATAAGGCTCCCTAC -3'
Posted On2016-06-06