Incidental Mutation 'R5021:Tspan32'
ID389194
Institutional Source Beutler Lab
Gene Symbol Tspan32
Ensembl Gene ENSMUSG00000000244
Gene Nametetraspanin 32
SynonymsArt-1, Tssc6, Phemx, Tspan32, D7Wsu37e
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5021 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143005046-143019644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143014978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000115344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009396] [ENSMUST00000075172] [ENSMUST00000082008] [ENSMUST00000105923] [ENSMUST00000105924] [ENSMUST00000105925] [ENSMUST00000143512] [ENSMUST00000145212] [ENSMUST00000207211]
Predicted Effect probably damaging
Transcript: ENSMUST00000009396
AA Change: D125G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009396
Gene: ENSMUSG00000000244
AA Change: D125G

DomainStartEndE-ValueType
Pfam:Tetraspannin 9 223 3.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075172
AA Change: D98G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074667
Gene: ENSMUSG00000000244
AA Change: D98G

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 198 3.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082008
AA Change: D98G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080668
Gene: ENSMUSG00000000244
AA Change: D98G

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 146 7.1e-13 PFAM
transmembrane domain 155 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105923
SMART Domains Protein: ENSMUSP00000101543
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105924
AA Change: D98G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101544
Gene: ENSMUSG00000000244
AA Change: D98G

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 148 1.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105925
SMART Domains Protein: ENSMUSP00000101545
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143512
AA Change: D70G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115344
Gene: ENSMUSG00000000244
AA Change: D70G

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145212
SMART Domains Protein: ENSMUSP00000116212
Gene: ENSMUSG00000000244

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154264
Predicted Effect probably benign
Transcript: ENSMUST00000207211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207449
Meta Mutation Damage Score 0.4984 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap null mutation exhibit normal hematopoiesis, hemolytic and granulopoitic responses. B cells exhibit normal proliferative responses while T cells demonstrate enhanced proliferation upon T cell receptor stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Tspan32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Tspan32 APN 7 143014954 intron probably benign
IGL02122:Tspan32 APN 7 143015635 missense probably damaging 0.99
IGL02830:Tspan32 APN 7 143017592 missense possibly damaging 0.93
theron UTSW 7 143017591 missense probably benign 0.37
R0594:Tspan32 UTSW 7 143015610 missense probably damaging 0.98
R1162:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R1317:Tspan32 UTSW 7 143017591 missense probably benign 0.37
R1513:Tspan32 UTSW 7 143005149 missense probably null 0.05
R2941:Tspan32 UTSW 7 143014992 missense probably damaging 1.00
R3953:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3955:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R3957:Tspan32 UTSW 7 143006998 missense probably damaging 1.00
R5849:Tspan32 UTSW 7 143015587 missense probably damaging 1.00
R6429:Tspan32 UTSW 7 143018742 missense possibly damaging 0.59
R7205:Tspan32 UTSW 7 143005126 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TACCCAGAAGCTACCACTGAGG -3'
(R):5'- TCTGAGACCTCCTCTTGAAGCC -3'

Sequencing Primer
(F):5'- GGTAGCTAAGTTCTGCTGACCTC -3'
(R):5'- CTCTTGAAGCCTTGCCAGGATG -3'
Posted On2016-06-06