Incidental Mutation 'R5021:Ighv1-19'
ID389206
Institutional Source Beutler Lab
Gene Symbol Ighv1-19
Ensembl Gene ENSMUSG00000096410
Gene Nameimmunoglobulin heavy variable V1-19
SynonymsGm16855
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R5021 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location114708648-114709135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114709066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000141737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103505] [ENSMUST00000193855]
Predicted Effect probably benign
Transcript: ENSMUST00000103505
AA Change: I6V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100286
Gene: ENSMUSG00000096410
AA Change: I6V

DomainStartEndE-ValueType
IGv 35 116 8.41e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192823
Predicted Effect probably benign
Transcript: ENSMUST00000193855
AA Change: I6V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141737
Gene: ENSMUSG00000096410
AA Change: I6V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 3.5e-31 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mlst8 C T 17: 24,477,219 D179N possibly damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Ighv1-19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ighv1-19 APN 12 114708709 missense probably benign 0.15
IGL00966:Ighv1-19 APN 12 114708949 missense possibly damaging 0.51
IGL02545:Ighv1-19 APN 12 114708739 missense probably damaging 1.00
R3729:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3730:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R3731:Ighv1-19 UTSW 12 114708877 missense probably damaging 1.00
R4093:Ighv1-19 UTSW 12 114708730 missense probably damaging 1.00
R4969:Ighv1-19 UTSW 12 114708757 missense probably benign 0.12
R6448:Ighv1-19 UTSW 12 114708676 missense probably damaging 1.00
R7335:Ighv1-19 UTSW 12 114708951 critical splice acceptor site probably benign
R8364:Ighv1-19 UTSW 12 114708926 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCTTCACTGAAGCCCCAGG -3'
(R):5'- GACCATCCTGCTGCTTGAAC -3'

Sequencing Primer
(F):5'- GCCCCAGGCTTCACCAG -3'
(R):5'- GCTGCTTGAACTATGTACCTTTAAG -3'
Posted On2016-06-06