Incidental Mutation 'R5021:Mlst8'
ID389208
Institutional Source Beutler Lab
Gene Symbol Mlst8
Ensembl Gene ENSMUSG00000024142
Gene NameMTOR associated protein, LST8 homolog (S. cerevisiae)
SynonymsGbl, mLST8, 0610033N12Rik
MMRRC Submission 042612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5021 (G1)
Quality Score139
Status Validated
Chromosome17
Chromosomal Location24473550-24479078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24477219 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 179 (D179N)
Ref Sequence ENSEMBL: ENSMUSP00000136287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054946] [ENSMUST00000070888] [ENSMUST00000164508] [ENSMUST00000179163]
Predicted Effect probably benign
Transcript: ENSMUST00000054946
SMART Domains Protein: ENSMUSP00000059792
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000070888
AA Change: D179N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065004
Gene: ENSMUSG00000024142
AA Change: D179N

DomainStartEndE-ValueType
Blast:WD40 1 28 6e-11 BLAST
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164508
SMART Domains Protein: ENSMUSP00000130417
Gene: ENSMUSG00000045744

DomainStartEndE-ValueType
BRICHOS 44 139 1.15e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179163
AA Change: D179N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136287
Gene: ENSMUSG00000024142
AA Change: D179N

DomainStartEndE-ValueType
Pfam:WD40 8 28 3.7e-3 PFAM
WD40 31 69 1.67e-1 SMART
WD40 74 113 1.19e-6 SMART
WD40 118 156 1.63e-4 SMART
WD40 159 198 4.46e-1 SMART
WD40 209 248 2.26e-7 SMART
WD40 259 298 1.7e-2 SMART
Meta Mutation Damage Score 0.1143 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 95% (39/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation exhibit lethality around E10.5 and abnormal yolk sac vasculature, brain development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A T 7: 51,556,185 T242S probably benign Het
B3gnt4 G C 5: 123,510,947 R125P probably damaging Het
Blvrb A C 7: 27,448,118 M1L probably benign Het
Cep112 T A 11: 108,470,328 H169Q possibly damaging Het
Clcn1 A T 6: 42,310,988 K718* probably null Het
Clhc1 A G 11: 29,560,627 N226S probably benign Het
Cpne1 T C 2: 156,098,273 probably benign Het
Cspg4 G A 9: 56,897,730 V1942I probably benign Het
Decr2 A T 17: 26,083,006 L250Q probably damaging Het
Depdc5 A G 5: 32,979,414 T1343A probably damaging Het
Eed A T 7: 89,972,305 L45M probably damaging Het
Ep300 T A 15: 81,640,023 S1351T unknown Het
Fam184b T A 5: 45,573,262 Q476L probably benign Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Ift122 A G 6: 115,864,372 D39G probably benign Het
Igf2bp1 A G 11: 95,974,006 Y206H probably damaging Het
Ighv1-19 T C 12: 114,709,066 I6V probably benign Het
Itm2c T C 1: 85,905,338 I131T probably damaging Het
Kcnd3 A T 3: 105,658,754 D417V probably damaging Het
Klf4 T C 4: 55,530,970 E38G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lct T C 1: 128,300,565 M1064V probably benign Het
Map4 C T 9: 110,038,089 Q265* probably null Het
Mcf2l T G 8: 13,011,808 V893G probably damaging Het
Mup6 T A 4: 59,964,352 N18K probably damaging Het
Nbeal2 G A 9: 110,637,463 R764W probably damaging Het
Ncoa6 A T 2: 155,406,949 S1478R probably benign Het
Pcdhga1 C A 18: 37,663,823 R627S probably damaging Het
Sacm1l A G 9: 123,582,328 D394G probably damaging Het
Schip1 A G 3: 68,495,252 T221A probably benign Het
Slc35c1 A G 2: 92,459,021 Y47H possibly damaging Het
Tspan32 A G 7: 143,014,978 D70G probably damaging Het
Vmn2r68 T C 7: 85,233,734 Y270C possibly damaging Het
Zfp777 A G 6: 48,042,127 V291A probably damaging Het
Other mutations in Mlst8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Mlst8 APN 17 24477313 missense probably damaging 1.00
IGL01893:Mlst8 APN 17 24477987 missense probably benign 0.02
IGL02984:Mlst8 UTSW 17 24476153 missense probably damaging 0.98
R0104:Mlst8 UTSW 17 24476117 missense possibly damaging 0.55
R0104:Mlst8 UTSW 17 24476117 missense possibly damaging 0.55
R1915:Mlst8 UTSW 17 24477290 nonsense probably null
R1952:Mlst8 UTSW 17 24478013 frame shift probably null
R1953:Mlst8 UTSW 17 24478013 frame shift probably null
R1954:Mlst8 UTSW 17 24477221 missense probably damaging 1.00
R3405:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R3406:Mlst8 UTSW 17 24478125 missense probably benign 0.03
R4517:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
R6344:Mlst8 UTSW 17 24477326 missense probably damaging 1.00
R6490:Mlst8 UTSW 17 24477961 missense probably benign 0.01
R6668:Mlst8 UTSW 17 24477479 unclassified probably null
R6931:Mlst8 UTSW 17 24477275 missense probably damaging 1.00
R7596:Mlst8 UTSW 17 24478110 critical splice donor site probably null
R7685:Mlst8 UTSW 17 24476057 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGACATGAGGAGTGGTACC -3'
(R):5'- CCAGGTGAGGAATGCTCATG -3'

Sequencing Primer
(F):5'- GTACCCAGGTGCCTGACTTTG -3'
(R):5'- TGAGGAATGCTCATGGGGCC -3'
Posted On2016-06-06