Incidental Mutation 'R0433:Phf14'
ID38921
Institutional Source Beutler Lab
Gene Symbol Phf14
Ensembl Gene ENSMUSG00000029629
Gene NamePHD finger protein 14
Synonyms5730446A07Rik, 4932409F11Rik, 1110001C23Rik
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0433 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location11907809-12081205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11933743 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 201 (S201R)
Ref Sequence ENSEMBL: ENSMUSP00000111173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511] [ENSMUST00000155037] [ENSMUST00000203459]
Predicted Effect probably damaging
Transcript: ENSMUST00000090632
AA Change: S201R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: S201R

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115510
AA Change: S201R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: S201R

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115511
AA Change: S201R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: S201R

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
RING 315 381 1.21e1 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
RING 721 769 2.63e0 SMART
low complexity region 830 848 N/A INTRINSIC
PHD 863 912 9.92e-9 SMART
RING 864 911 3.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133776
SMART Domains Protein: ENSMUSP00000115485
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PHD 40 97 1.64e-9 SMART
PHD 159 218 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155037
SMART Domains Protein: ENSMUSP00000144981
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203459
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Phf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Phf14 APN 6 11941424 splice site probably benign
IGL01120:Phf14 APN 6 11962740 missense probably damaging 1.00
IGL01575:Phf14 APN 6 11990051 missense probably damaging 1.00
IGL02153:Phf14 APN 6 11934016 missense probably damaging 0.99
IGL02735:Phf14 APN 6 11987612 missense probably benign 0.21
IGL03294:Phf14 APN 6 11953367 missense probably damaging 1.00
IGL03392:Phf14 APN 6 11962659 missense probably damaging 1.00
R0060:Phf14 UTSW 6 11953317 missense probably damaging 0.97
R0099:Phf14 UTSW 6 11987697 unclassified probably benign
R0384:Phf14 UTSW 6 11997020 splice site probably benign
R0563:Phf14 UTSW 6 11933601 intron probably benign
R0590:Phf14 UTSW 6 11961578 missense possibly damaging 0.72
R1066:Phf14 UTSW 6 11987255 missense possibly damaging 0.47
R1187:Phf14 UTSW 6 11941496 missense probably damaging 0.97
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1491:Phf14 UTSW 6 11941479 missense possibly damaging 0.80
R1543:Phf14 UTSW 6 11987683 critical splice donor site probably null
R1595:Phf14 UTSW 6 11988753 missense possibly damaging 0.69
R1861:Phf14 UTSW 6 11987611 missense probably benign 0.00
R2289:Phf14 UTSW 6 12047846 missense probably damaging 1.00
R2437:Phf14 UTSW 6 11962658 missense probably damaging 1.00
R3831:Phf14 UTSW 6 11933874 unclassified probably null
R3832:Phf14 UTSW 6 11933874 unclassified probably null
R3833:Phf14 UTSW 6 11933874 unclassified probably null
R4290:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4293:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4294:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4295:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4572:Phf14 UTSW 6 12006824 missense probably damaging 1.00
R4663:Phf14 UTSW 6 11953422 missense possibly damaging 0.92
R4673:Phf14 UTSW 6 11992057 missense probably damaging 1.00
R4882:Phf14 UTSW 6 11988757 missense possibly damaging 0.88
R4954:Phf14 UTSW 6 11987620 missense probably benign 0.09
R5148:Phf14 UTSW 6 11961642 missense possibly damaging 0.72
R5284:Phf14 UTSW 6 11997120 missense probably damaging 0.99
R5569:Phf14 UTSW 6 11934016 missense probably damaging 0.99
R5694:Phf14 UTSW 6 11990125 missense possibly damaging 0.68
R5726:Phf14 UTSW 6 11933538 intron probably benign
R5730:Phf14 UTSW 6 11953320 missense possibly damaging 0.54
R5819:Phf14 UTSW 6 11997252 intron probably null
R5915:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R6578:Phf14 UTSW 6 11991997 missense probably damaging 1.00
R6950:Phf14 UTSW 6 12006855 missense probably damaging 1.00
R7181:Phf14 UTSW 6 11933341 missense unknown
R7352:Phf14 UTSW 6 11961638 missense probably damaging 1.00
R7355:Phf14 UTSW 6 12081007 missense probably benign 0.01
X0025:Phf14 UTSW 6 11926813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATGTCTACCATCCTTTGCCTTAG -3'
(R):5'- AGGGCTGCTATGATCTTCATCATTGC -3'

Sequencing Primer
(F):5'- gaaagaaaaaggagaaagaaaaggag -3'
(R):5'- ccctcatcattctcatcttcctc -3'
Posted On2013-05-23