Mutagenetix > Incidental Mutation

Incidental Mutation 'R5022:Tlk1'

389216

Institutional Source

Beutler Lab

Gene Symbol

Tlk1

Ensembl Gene

ENSMUSG00000041997

Gene Name

tousled-like kinase 1

Synonyms

4930545J15Rik

MMRRC Submission

042613-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70712407-70825728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70742065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 386 (N386K)

Ref Sequence

ENSEMBL: ENSMUSP00000035961 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038584]

AlphaFold

Q8C0V0

Predicted Effect

probably benign
Transcript: ENSMUST00000038584
AA Change: N386K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000035961
Gene: ENSMUSG00000041997
AA Change: N386K

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
low complexity region	68	85	N/A	INTRINSIC
low complexity region	170	192	N/A	INTRINSIC
coiled coil region	248	277	N/A	INTRINSIC
coiled coil region	403	441	N/A	INTRINSIC
S_TKc	456	734	4.41e-75	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132542

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135128

Meta Mutation Damage Score

0.0622

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase that may be involved in the regulation of chromatin assembly. The encoded protein is only active when it is phosphorylated, and this phosphorylation is cell cycle-dependent, with the maximal activity of this protein coming during S phase. The catalytic activity of this protein is diminished by DNA damage and by blockage of DNA replication. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Tlk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Tlk1	APN	2	70745516	missense	probably damaging	1.00
IGL01087:Tlk1	APN	2	70752316	missense	possibly damaging	0.64
IGL01514:Tlk1	APN	2	70752266	missense	probably benign	0.00
IGL02976:Tlk1	APN	2	70721591	nonsense	probably null
IGL03024:Tlk1	APN	2	70746036	nonsense	probably null
Aku-aku	UTSW	2	70738445	missense	probably damaging	0.98
Heyerdahl	UTSW	2	70738426	nonsense	probably null
K3955:Tlk1	UTSW	2	70721701	missense	possibly damaging	0.85
R0107:Tlk1	UTSW	2	70713989	makesense	probably null
R0226:Tlk1	UTSW	2	70714169	unclassified	probably benign
R0332:Tlk1	UTSW	2	70745565	splice site	probably null
R0601:Tlk1	UTSW	2	70714158	missense	probably benign	0.44
R1739:Tlk1	UTSW	2	70721077	missense	probably damaging	1.00
R2080:Tlk1	UTSW	2	70738445	missense	probably damaging	0.98
R2422:Tlk1	UTSW	2	70770005	missense	probably damaging	1.00
R3843:Tlk1	UTSW	2	70749327	missense	probably benign	0.05
R3970:Tlk1	UTSW	2	70716652	missense	probably damaging	1.00
R4191:Tlk1	UTSW	2	70725547	missense	probably damaging	1.00
R4867:Tlk1	UTSW	2	70721571	nonsense	probably null
R5275:Tlk1	UTSW	2	70752205	intron	probably benign
R5469:Tlk1	UTSW	2	70721668	missense	probably benign	0.15
R6531:Tlk1	UTSW	2	70742083	missense	probably benign	0.00
R6592:Tlk1	UTSW	2	70714153	missense	probably damaging	1.00
R6797:Tlk1	UTSW	2	70738426	nonsense	probably null
R7030:Tlk1	UTSW	2	70721928	missense	probably damaging	1.00
R7705:Tlk1	UTSW	2	70786672	splice site	probably null
R7970:Tlk1	UTSW	2	70752300	missense	possibly damaging	0.64
R8284:Tlk1	UTSW	2	70714021	missense	probably benign
R8765:Tlk1	UTSW	2	70752237	missense	probably benign	0.20
R9004:Tlk1	UTSW	2	70721946	missense	probably damaging	1.00
R9059:Tlk1	UTSW	2	70786933	missense	possibly damaging	0.65
R9114:Tlk1	UTSW	2	70742158	missense	probably benign	0.20
R9408:Tlk1	UTSW	2	70786875	critical splice donor site	probably null
R9464:Tlk1	UTSW	2	70713997	missense	probably benign	0.00
R9622:Tlk1	UTSW	2	70786937	missense	probably damaging	1.00
R9768:Tlk1	UTSW	2	70770056	missense	probably damaging	0.99
R9776:Tlk1	UTSW	2	70725564	missense	probably damaging	1.00
X0028:Tlk1	UTSW	2	70746031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGCAGTGGTATAGGCAAC -3'
(R):5'- TTTACACAGGCAACAAGAATGG -3'

Sequencing Primer
(F):5'- TTCAGATACGAAAGGGGGTAAATCC -3'
(R):5'- CACAGGCAACAAGAATGGGTGAATC -3'

Posted On

2016-06-06