Incidental Mutation 'R5022:Helz2'
ID 389227
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission 042613-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5022 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 180869408-180883820 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180882362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 144 (R144G)
Ref Sequence ENSEMBL: ENSMUSP00000112917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094203
AA Change: R144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: R144G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: R144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: R144G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: R144G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: R144G

DomainStartEndE-ValueType
low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155049
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 (GRCm39) probably null Het
Abca15 T C 7: 119,945,319 (GRCm39) I465T probably damaging Het
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcb4 T A 5: 8,959,054 (GRCm39) probably null Het
Acan T C 7: 78,742,556 (GRCm39) probably null Het
Aebp2 G A 6: 140,583,456 (GRCm39) R109Q possibly damaging Het
Agfg2 A T 5: 137,658,422 (GRCm39) probably null Het
Ankib1 T A 5: 3,784,011 (GRCm39) I322F possibly damaging Het
AW551984 A T 9: 39,509,261 (GRCm39) N293K probably benign Het
BC028528 T A 3: 95,796,135 (GRCm39) probably benign Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
Birc6 A G 17: 74,999,327 (GRCm39) Y4656C probably damaging Het
Bmp3 A G 5: 99,020,683 (GRCm39) R369G probably damaging Het
C1d T A 11: 17,216,674 (GRCm39) N135K probably benign Het
Ccdc148 G A 2: 58,717,644 (GRCm39) A453V probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Celf2 C T 2: 6,612,658 (GRCm39) probably benign Het
Chga T C 12: 102,529,096 (GRCm39) W358R probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Crim1 T C 17: 78,587,558 (GRCm39) V221A possibly damaging Het
D630003M21Rik A T 2: 158,059,553 (GRCm39) S116T probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dmxl1 T A 18: 50,028,194 (GRCm39) I2206K probably damaging Het
Dusp7 T A 9: 106,250,940 (GRCm39) L355Q probably damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif1ad16 A T 12: 87,985,481 (GRCm39) S21T unknown Het
Exd2 T A 12: 80,543,564 (GRCm39) N582K probably damaging Het
Fbln1 G A 15: 85,121,827 (GRCm39) S316N probably damaging Het
Fchsd1 A G 18: 38,097,863 (GRCm39) I340T possibly damaging Het
Fn1 T C 1: 71,663,338 (GRCm39) Y1050C probably damaging Het
Fsip2 A G 2: 82,809,773 (GRCm39) I2031V probably benign Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm15455 T C 1: 33,876,432 (GRCm39) noncoding transcript Het
Gm1818 G C 12: 48,602,318 (GRCm39) noncoding transcript Het
Gm5420 A T 10: 21,567,626 (GRCm39) noncoding transcript Het
Gm7104 A T 12: 88,252,529 (GRCm39) noncoding transcript Het
Gp2 A G 7: 119,048,337 (GRCm39) I427T probably damaging Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpr142 A C 11: 114,695,214 (GRCm39) S60R probably benign Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hnf4g G T 3: 3,709,647 (GRCm39) A144S probably damaging Het
Irs2 A C 8: 11,037,012 (GRCm39) *1322G probably null Het
Keg1 A G 19: 12,696,521 (GRCm39) N288S probably damaging Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Klhl1 G A 14: 96,374,142 (GRCm39) P635S probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lsm11 T C 11: 45,835,666 (GRCm39) D25G probably damaging Het
Manea A T 4: 26,336,630 (GRCm39) Y215* probably null Het
Mdga2 C T 12: 66,517,534 (GRCm39) C100Y possibly damaging Het
Mthfd1 T G 12: 76,341,148 (GRCm39) V480G probably damaging Het
Mthfd1 T A 12: 76,348,102 (GRCm39) M582K probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nanos1 T C 19: 60,745,418 (GRCm39) Y239H probably damaging Het
Nat8 G A 6: 85,807,839 (GRCm39) T98I possibly damaging Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Nexmif A T X: 103,130,956 (GRCm39) N320K probably damaging Het
Or10h1 T C 17: 33,418,751 (GRCm39) F239S probably damaging Het
Or2m12 A T 16: 19,104,809 (GRCm39) V228D probably damaging Het
Or2r3 A T 6: 42,448,221 (GRCm39) V297E possibly damaging Het
Or4c111 A G 2: 88,844,387 (GRCm39) V7A probably damaging Het
Or4c122 C T 2: 89,079,761 (GRCm39) M92I probably benign Het
Or4k15 T C 14: 50,364,469 (GRCm39) V145A possibly damaging Het
Or52e2 G A 7: 102,804,942 (GRCm39) P4L probably benign Het
Or6c69c T C 10: 129,910,462 (GRCm39) L61P probably damaging Het
Pcdhb14 T A 18: 37,583,223 (GRCm39) N776K probably benign Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Plk4 G A 3: 40,756,512 (GRCm39) probably null Het
Prmt8 A G 6: 127,688,126 (GRCm39) Y231H possibly damaging Het
Prpf4b T C 13: 35,067,582 (GRCm39) probably benign Het
Ptpn21 G A 12: 98,645,666 (GRCm39) R1091C probably damaging Het
Pwwp2b C T 7: 138,835,494 (GRCm39) P312S possibly damaging Het
Rad21 A T 15: 51,830,102 (GRCm39) I503K probably benign Het
Rai14 A G 15: 10,574,592 (GRCm39) S789P probably damaging Het
Rbm26 C T 14: 105,381,688 (GRCm39) D486N probably damaging Het
Rnf20 A G 4: 49,642,016 (GRCm39) probably benign Het
Ros1 A G 10: 52,000,171 (GRCm39) V1118A possibly damaging Het
Sema3d A C 5: 12,634,923 (GRCm39) Y663S probably damaging Het
Serpina6 A G 12: 103,617,971 (GRCm39) W281R probably damaging Het
Slc8a3 A G 12: 81,246,332 (GRCm39) V900A probably damaging Het
Spats2l G T 1: 57,918,715 (GRCm39) V30L probably damaging Het
Spg21 A G 9: 65,383,231 (GRCm39) D139G probably damaging Het
Sun3 T C 11: 8,988,314 (GRCm39) T3A probably damaging Het
Tep1 A G 14: 51,066,456 (GRCm39) Y2335H probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Timd5 T A 11: 46,419,359 (GRCm39) D58E probably damaging Het
Timm21 C A 18: 84,967,539 (GRCm39) V112L possibly damaging Het
Tlk1 A T 2: 70,572,409 (GRCm39) N386K probably benign Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trgv1 T A 13: 19,524,401 (GRCm39) S42T probably benign Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ucp2 A T 7: 100,147,579 (GRCm39) N186I possibly damaging Het
Vmn1r119 A G 7: 20,746,245 (GRCm39) S46P probably benign Het
Vmn2r101 A T 17: 19,831,649 (GRCm39) probably null Het
Vmn2r105 T A 17: 20,428,676 (GRCm39) H800L probably damaging Het
Vmn2r69 T C 7: 85,060,367 (GRCm39) M406V possibly damaging Het
Vmn2r84 A G 10: 130,222,417 (GRCm39) L601P probably damaging Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Wap T C 11: 6,587,339 (GRCm39) probably benign Het
Wdr11 A G 7: 129,226,435 (GRCm39) I744M probably benign Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Zfp524 A T 7: 5,021,416 (GRCm39) I315F probably benign Het
Zfp62 T A 11: 49,106,556 (GRCm39) S216T probably damaging Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 180,871,495 (GRCm39) missense probably damaging 1.00
IGL00515:Helz2 APN 2 180,874,799 (GRCm39) nonsense probably null
IGL00704:Helz2 APN 2 180,876,178 (GRCm39) missense probably damaging 1.00
IGL00847:Helz2 APN 2 180,874,038 (GRCm39) missense possibly damaging 0.73
IGL01448:Helz2 APN 2 180,875,770 (GRCm39) missense probably damaging 1.00
IGL01783:Helz2 APN 2 180,874,674 (GRCm39) missense probably damaging 1.00
IGL01790:Helz2 APN 2 180,880,274 (GRCm39) missense probably benign 0.29
IGL02116:Helz2 APN 2 180,873,978 (GRCm39) missense probably damaging 1.00
IGL02226:Helz2 APN 2 180,873,483 (GRCm39) missense probably damaging 1.00
IGL02402:Helz2 APN 2 180,872,704 (GRCm39) missense probably damaging 1.00
IGL02403:Helz2 APN 2 180,872,815 (GRCm39) missense probably damaging 1.00
IGL02733:Helz2 APN 2 180,876,819 (GRCm39) missense probably benign 0.14
IGL02869:Helz2 APN 2 180,872,939 (GRCm39) intron probably benign
IGL03003:Helz2 APN 2 180,882,046 (GRCm39) missense probably damaging 1.00
IGL03060:Helz2 APN 2 180,871,015 (GRCm39) critical splice donor site probably null
IGL03310:Helz2 APN 2 180,873,597 (GRCm39) missense probably benign 0.00
Colby UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
ANU74:Helz2 UTSW 2 180,876,627 (GRCm39) missense probably benign 0.03
R0013:Helz2 UTSW 2 180,882,752 (GRCm39) missense probably benign
R0013:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0014:Helz2 UTSW 2 180,882,304 (GRCm39) missense probably damaging 1.00
R0016:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0018:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0019:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0055:Helz2 UTSW 2 180,870,614 (GRCm39) missense possibly damaging 0.47
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0071:Helz2 UTSW 2 180,878,200 (GRCm39) missense probably damaging 1.00
R0111:Helz2 UTSW 2 180,879,595 (GRCm39) missense probably benign 0.30
R0117:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0135:Helz2 UTSW 2 180,874,062 (GRCm39) missense probably damaging 1.00
R0194:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0242:Helz2 UTSW 2 180,872,223 (GRCm39) missense probably damaging 1.00
R0254:Helz2 UTSW 2 180,874,552 (GRCm39) missense probably damaging 1.00
R0410:Helz2 UTSW 2 180,872,386 (GRCm39) missense probably damaging 1.00
R0442:Helz2 UTSW 2 180,874,002 (GRCm39) missense probably damaging 0.97
R0497:Helz2 UTSW 2 180,871,449 (GRCm39) missense probably damaging 0.97
R0517:Helz2 UTSW 2 180,869,563 (GRCm39) missense probably benign 0.00
R0541:Helz2 UTSW 2 180,876,618 (GRCm39) missense possibly damaging 0.89
R0542:Helz2 UTSW 2 180,873,882 (GRCm39) missense probably damaging 1.00
R0591:Helz2 UTSW 2 180,873,909 (GRCm39) missense probably damaging 0.96
R0692:Helz2 UTSW 2 180,882,674 (GRCm39) missense probably benign
R0826:Helz2 UTSW 2 180,882,646 (GRCm39) missense possibly damaging 0.51
R0834:Helz2 UTSW 2 180,872,570 (GRCm39) missense probably damaging 1.00
R0880:Helz2 UTSW 2 180,877,928 (GRCm39) missense probably benign
R1170:Helz2 UTSW 2 180,871,608 (GRCm39) missense probably damaging 1.00
R1186:Helz2 UTSW 2 180,872,921 (GRCm39) missense probably damaging 1.00
R1344:Helz2 UTSW 2 180,879,389 (GRCm39) missense possibly damaging 0.89
R1358:Helz2 UTSW 2 180,874,774 (GRCm39) missense probably damaging 1.00
R1436:Helz2 UTSW 2 180,877,317 (GRCm39) missense probably damaging 0.99
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1464:Helz2 UTSW 2 180,881,447 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1466:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1477:Helz2 UTSW 2 180,874,597 (GRCm39) missense probably benign 0.00
R1564:Helz2 UTSW 2 180,875,021 (GRCm39) missense probably benign 0.01
R1584:Helz2 UTSW 2 180,878,090 (GRCm39) missense probably damaging 1.00
R1655:Helz2 UTSW 2 180,875,940 (GRCm39) missense probably damaging 0.99
R1757:Helz2 UTSW 2 180,878,056 (GRCm39) missense probably damaging 1.00
R1779:Helz2 UTSW 2 180,880,252 (GRCm39) missense possibly damaging 0.84
R1779:Helz2 UTSW 2 180,876,780 (GRCm39) missense probably benign
R1837:Helz2 UTSW 2 180,871,082 (GRCm39) missense probably damaging 1.00
R1845:Helz2 UTSW 2 180,873,878 (GRCm39) missense probably benign 0.02
R1894:Helz2 UTSW 2 180,876,082 (GRCm39) missense probably damaging 1.00
R1913:Helz2 UTSW 2 180,875,543 (GRCm39) missense probably damaging 1.00
R2005:Helz2 UTSW 2 180,873,122 (GRCm39) missense probably benign 0.45
R2034:Helz2 UTSW 2 180,874,371 (GRCm39) missense probably damaging 1.00
R2036:Helz2 UTSW 2 180,879,272 (GRCm39) missense probably benign 0.03
R2061:Helz2 UTSW 2 180,882,337 (GRCm39) missense probably damaging 1.00
R2088:Helz2 UTSW 2 180,876,895 (GRCm39) missense probably benign 0.07
R2142:Helz2 UTSW 2 180,873,173 (GRCm39) missense probably benign
R2180:Helz2 UTSW 2 180,875,525 (GRCm39) missense probably damaging 1.00
R2192:Helz2 UTSW 2 180,870,841 (GRCm39) nonsense probably null
R2248:Helz2 UTSW 2 180,875,226 (GRCm39) missense probably benign 0.33
R2495:Helz2 UTSW 2 180,874,705 (GRCm39) missense probably damaging 0.99
R2886:Helz2 UTSW 2 180,882,535 (GRCm39) missense probably benign
R3617:Helz2 UTSW 2 180,874,854 (GRCm39) missense probably damaging 1.00
R3776:Helz2 UTSW 2 180,882,182 (GRCm39) nonsense probably null
R3803:Helz2 UTSW 2 180,881,789 (GRCm39) missense probably damaging 0.96
R4043:Helz2 UTSW 2 180,871,503 (GRCm39) missense probably benign 0.00
R4052:Helz2 UTSW 2 180,882,268 (GRCm39) missense probably damaging 1.00
R4232:Helz2 UTSW 2 180,871,695 (GRCm39) missense probably damaging 1.00
R4521:Helz2 UTSW 2 180,870,626 (GRCm39) missense probably benign
R4624:Helz2 UTSW 2 180,881,101 (GRCm39) missense probably damaging 0.99
R4720:Helz2 UTSW 2 180,880,210 (GRCm39) missense probably damaging 1.00
R4831:Helz2 UTSW 2 180,879,210 (GRCm39) missense probably damaging 1.00
R4852:Helz2 UTSW 2 180,871,913 (GRCm39) missense probably damaging 1.00
R4894:Helz2 UTSW 2 180,877,940 (GRCm39) missense probably benign 0.01
R4915:Helz2 UTSW 2 180,874,231 (GRCm39) missense possibly damaging 0.80
R4965:Helz2 UTSW 2 180,882,709 (GRCm39) missense possibly damaging 0.79
R5089:Helz2 UTSW 2 180,876,942 (GRCm39) missense probably benign 0.14
R5190:Helz2 UTSW 2 180,872,550 (GRCm39) critical splice donor site probably null
R5309:Helz2 UTSW 2 180,876,639 (GRCm39) missense probably benign 0.08
R5358:Helz2 UTSW 2 180,877,321 (GRCm39) missense probably damaging 1.00
R5379:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R5559:Helz2 UTSW 2 180,871,919 (GRCm39) missense probably damaging 0.98
R5591:Helz2 UTSW 2 180,882,051 (GRCm39) missense probably damaging 0.99
R5596:Helz2 UTSW 2 180,879,082 (GRCm39) intron probably benign
R5805:Helz2 UTSW 2 180,882,301 (GRCm39) missense probably damaging 1.00
R5823:Helz2 UTSW 2 180,878,189 (GRCm39) missense possibly damaging 0.92
R5825:Helz2 UTSW 2 180,874,449 (GRCm39) missense probably benign 0.02
R5873:Helz2 UTSW 2 180,875,821 (GRCm39) missense possibly damaging 0.78
R5928:Helz2 UTSW 2 180,872,177 (GRCm39) missense possibly damaging 0.82
R5936:Helz2 UTSW 2 180,872,560 (GRCm39) missense probably damaging 1.00
R5975:Helz2 UTSW 2 180,872,843 (GRCm39) missense probably benign 0.08
R6045:Helz2 UTSW 2 180,882,106 (GRCm39) missense probably benign 0.03
R6077:Helz2 UTSW 2 180,874,831 (GRCm39) missense probably benign 0.41
R6218:Helz2 UTSW 2 180,874,087 (GRCm39) missense probably benign 0.03
R6218:Helz2 UTSW 2 180,877,738 (GRCm39) missense probably damaging 1.00
R6315:Helz2 UTSW 2 180,874,995 (GRCm39) missense probably damaging 1.00
R6346:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6371:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6372:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6373:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6385:Helz2 UTSW 2 180,875,260 (GRCm39) missense probably damaging 1.00
R6464:Helz2 UTSW 2 180,876,862 (GRCm39) missense probably benign
R6581:Helz2 UTSW 2 180,871,172 (GRCm39) missense probably damaging 0.99
R6651:Helz2 UTSW 2 180,881,350 (GRCm39) nonsense probably null
R6964:Helz2 UTSW 2 180,872,221 (GRCm39) missense probably damaging 1.00
R7061:Helz2 UTSW 2 180,882,307 (GRCm39) missense probably damaging 1.00
R7153:Helz2 UTSW 2 180,873,078 (GRCm39) missense probably benign 0.00
R7372:Helz2 UTSW 2 180,880,216 (GRCm39) missense possibly damaging 0.61
R7512:Helz2 UTSW 2 180,877,393 (GRCm39) splice site probably null
R7512:Helz2 UTSW 2 180,872,647 (GRCm39) missense probably benign 0.00
R7583:Helz2 UTSW 2 180,879,365 (GRCm39) missense probably benign 0.06
R7724:Helz2 UTSW 2 180,873,789 (GRCm39) missense probably damaging 1.00
R7733:Helz2 UTSW 2 180,872,148 (GRCm39) missense possibly damaging 0.63
R7748:Helz2 UTSW 2 180,876,324 (GRCm39) missense probably damaging 1.00
R7774:Helz2 UTSW 2 180,875,784 (GRCm39) missense probably benign
R7799:Helz2 UTSW 2 180,879,782 (GRCm39) missense probably benign 0.15
R7841:Helz2 UTSW 2 180,874,695 (GRCm39) missense probably damaging 1.00
R7939:Helz2 UTSW 2 180,879,543 (GRCm39) missense probably damaging 0.99
R8026:Helz2 UTSW 2 180,881,998 (GRCm39) missense probably benign 0.34
R8030:Helz2 UTSW 2 180,879,689 (GRCm39) missense possibly damaging 0.55
R8080:Helz2 UTSW 2 180,880,055 (GRCm39) missense probably damaging 0.99
R8237:Helz2 UTSW 2 180,871,124 (GRCm39) missense possibly damaging 0.65
R8245:Helz2 UTSW 2 180,879,895 (GRCm39) missense probably damaging 1.00
R8304:Helz2 UTSW 2 180,871,950 (GRCm39) missense probably benign 0.03
R8486:Helz2 UTSW 2 180,871,124 (GRCm39) missense probably damaging 1.00
R8556:Helz2 UTSW 2 180,871,350 (GRCm39) missense probably damaging 1.00
R8878:Helz2 UTSW 2 180,874,560 (GRCm39) missense possibly damaging 0.67
R8907:Helz2 UTSW 2 180,874,920 (GRCm39) missense possibly damaging 0.47
R8911:Helz2 UTSW 2 180,880,173 (GRCm39) missense
R8953:Helz2 UTSW 2 180,874,884 (GRCm39) missense probably damaging 1.00
R8963:Helz2 UTSW 2 180,871,407 (GRCm39) missense probably damaging 1.00
R8969:Helz2 UTSW 2 180,879,581 (GRCm39) missense probably benign 0.19
R8976:Helz2 UTSW 2 180,876,486 (GRCm39) missense possibly damaging 0.46
R9015:Helz2 UTSW 2 180,870,792 (GRCm39) missense probably damaging 1.00
R9031:Helz2 UTSW 2 180,874,261 (GRCm39) missense possibly damaging 0.78
R9052:Helz2 UTSW 2 180,881,968 (GRCm39) missense possibly damaging 0.78
R9089:Helz2 UTSW 2 180,881,433 (GRCm39) missense probably damaging 1.00
R9145:Helz2 UTSW 2 180,881,848 (GRCm39) missense probably damaging 1.00
R9185:Helz2 UTSW 2 180,871,883 (GRCm39) missense probably benign
R9186:Helz2 UTSW 2 180,876,457 (GRCm39) missense possibly damaging 0.57
R9373:Helz2 UTSW 2 180,882,741 (GRCm39) missense probably benign
R9407:Helz2 UTSW 2 180,881,975 (GRCm39) missense probably benign 0.01
R9465:Helz2 UTSW 2 180,874,710 (GRCm39) missense probably benign 0.01
R9502:Helz2 UTSW 2 180,878,245 (GRCm39) missense possibly damaging 0.47
R9538:Helz2 UTSW 2 180,882,014 (GRCm39) missense probably damaging 1.00
R9554:Helz2 UTSW 2 180,882,470 (GRCm39) missense probably damaging 0.96
R9659:Helz2 UTSW 2 180,882,025 (GRCm39) missense probably benign 0.00
R9800:Helz2 UTSW 2 180,882,616 (GRCm39) missense probably damaging 0.99
X0064:Helz2 UTSW 2 180,873,534 (GRCm39) missense probably damaging 1.00
Z1176:Helz2 UTSW 2 180,879,357 (GRCm39) missense probably benign 0.39
Z1177:Helz2 UTSW 2 180,877,754 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGCCCTCAACTATAACATGG -3'
(R):5'- GCAAGATCTGGCGTAAGGTG -3'

Sequencing Primer
(F):5'- GGCCCTCAACTATAACATGGATGAG -3'
(R):5'- AGGCCTAGCTTCCCAACG -3'
Posted On 2016-06-06