Incidental Mutation 'R5022:Manea'
ID 389231
Institutional Source Beutler Lab
Gene Symbol Manea
Ensembl Gene ENSMUSG00000040520
Gene Name mannosidase, endo-alpha
Synonyms 4932703L02Rik
MMRRC Submission 042613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5022 (G1)
Quality Score 211
Status Validated
Chromosome 4
Chromosomal Location 26324506-26346891 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 26336630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 215 (Y215*)
Ref Sequence ENSEMBL: ENSMUSP00000038671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041374] [ENSMUST00000153813]
AlphaFold Q6NXH2
Predicted Effect probably null
Transcript: ENSMUST00000041374
AA Change: Y215*
SMART Domains Protein: ENSMUSP00000038671
Gene: ENSMUSG00000040520
AA Change: Y215*

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_hydro_99 98 448 3.2e-192 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140492
Predicted Effect probably benign
Transcript: ENSMUST00000153813
SMART Domains Protein: ENSMUSP00000115791
Gene: ENSMUSG00000040520

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-glycosylation of proteins is initiated in the endoplasmic reticulum (ER) by the transfer of the preassembled oligosaccharide glucose-3-mannose-9-N-acetylglucosamine-2 from dolichyl pyrophosphate to acceptor sites on the target protein by an oligosaccharyltransferase complex. This core oligosaccharide is sequentially processed by several ER glycosidases and by an endomannosidase (E.C. 3.2.1.130), such as MANEA, in the Golgi. MANEA catalyzes the release of mono-, di-, and triglucosylmannose oligosaccharides by cleaving the alpha-1,2-mannosidic bond that links them to high-mannose glycans (Hamilton et al., 2005 [PubMed 15677381]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 (GRCm39) probably null Het
Abca15 T C 7: 119,945,319 (GRCm39) I465T probably damaging Het
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcb4 T A 5: 8,959,054 (GRCm39) probably null Het
Acan T C 7: 78,742,556 (GRCm39) probably null Het
Aebp2 G A 6: 140,583,456 (GRCm39) R109Q possibly damaging Het
Agfg2 A T 5: 137,658,422 (GRCm39) probably null Het
Ankib1 T A 5: 3,784,011 (GRCm39) I322F possibly damaging Het
AW551984 A T 9: 39,509,261 (GRCm39) N293K probably benign Het
BC028528 T A 3: 95,796,135 (GRCm39) probably benign Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
Birc6 A G 17: 74,999,327 (GRCm39) Y4656C probably damaging Het
Bmp3 A G 5: 99,020,683 (GRCm39) R369G probably damaging Het
C1d T A 11: 17,216,674 (GRCm39) N135K probably benign Het
Ccdc148 G A 2: 58,717,644 (GRCm39) A453V probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Celf2 C T 2: 6,612,658 (GRCm39) probably benign Het
Chga T C 12: 102,529,096 (GRCm39) W358R probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Crim1 T C 17: 78,587,558 (GRCm39) V221A possibly damaging Het
D630003M21Rik A T 2: 158,059,553 (GRCm39) S116T probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dmxl1 T A 18: 50,028,194 (GRCm39) I2206K probably damaging Het
Dusp7 T A 9: 106,250,940 (GRCm39) L355Q probably damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif1ad16 A T 12: 87,985,481 (GRCm39) S21T unknown Het
Exd2 T A 12: 80,543,564 (GRCm39) N582K probably damaging Het
Fbln1 G A 15: 85,121,827 (GRCm39) S316N probably damaging Het
Fchsd1 A G 18: 38,097,863 (GRCm39) I340T possibly damaging Het
Fn1 T C 1: 71,663,338 (GRCm39) Y1050C probably damaging Het
Fsip2 A G 2: 82,809,773 (GRCm39) I2031V probably benign Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm15455 T C 1: 33,876,432 (GRCm39) noncoding transcript Het
Gm1818 G C 12: 48,602,318 (GRCm39) noncoding transcript Het
Gm5420 A T 10: 21,567,626 (GRCm39) noncoding transcript Het
Gm7104 A T 12: 88,252,529 (GRCm39) noncoding transcript Het
Gp2 A G 7: 119,048,337 (GRCm39) I427T probably damaging Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpr142 A C 11: 114,695,214 (GRCm39) S60R probably benign Het
Helz2 T C 2: 180,882,362 (GRCm39) R144G probably benign Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hnf4g G T 3: 3,709,647 (GRCm39) A144S probably damaging Het
Irs2 A C 8: 11,037,012 (GRCm39) *1322G probably null Het
Keg1 A G 19: 12,696,521 (GRCm39) N288S probably damaging Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Klhl1 G A 14: 96,374,142 (GRCm39) P635S probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lsm11 T C 11: 45,835,666 (GRCm39) D25G probably damaging Het
Mdga2 C T 12: 66,517,534 (GRCm39) C100Y possibly damaging Het
Mthfd1 T G 12: 76,341,148 (GRCm39) V480G probably damaging Het
Mthfd1 T A 12: 76,348,102 (GRCm39) M582K probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nanos1 T C 19: 60,745,418 (GRCm39) Y239H probably damaging Het
Nat8 G A 6: 85,807,839 (GRCm39) T98I possibly damaging Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Nexmif A T X: 103,130,956 (GRCm39) N320K probably damaging Het
Or10h1 T C 17: 33,418,751 (GRCm39) F239S probably damaging Het
Or2m12 A T 16: 19,104,809 (GRCm39) V228D probably damaging Het
Or2r3 A T 6: 42,448,221 (GRCm39) V297E possibly damaging Het
Or4c111 A G 2: 88,844,387 (GRCm39) V7A probably damaging Het
Or4c122 C T 2: 89,079,761 (GRCm39) M92I probably benign Het
Or4k15 T C 14: 50,364,469 (GRCm39) V145A possibly damaging Het
Or52e2 G A 7: 102,804,942 (GRCm39) P4L probably benign Het
Or6c69c T C 10: 129,910,462 (GRCm39) L61P probably damaging Het
Pcdhb14 T A 18: 37,583,223 (GRCm39) N776K probably benign Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Plk4 G A 3: 40,756,512 (GRCm39) probably null Het
Prmt8 A G 6: 127,688,126 (GRCm39) Y231H possibly damaging Het
Prpf4b T C 13: 35,067,582 (GRCm39) probably benign Het
Ptpn21 G A 12: 98,645,666 (GRCm39) R1091C probably damaging Het
Pwwp2b C T 7: 138,835,494 (GRCm39) P312S possibly damaging Het
Rad21 A T 15: 51,830,102 (GRCm39) I503K probably benign Het
Rai14 A G 15: 10,574,592 (GRCm39) S789P probably damaging Het
Rbm26 C T 14: 105,381,688 (GRCm39) D486N probably damaging Het
Rnf20 A G 4: 49,642,016 (GRCm39) probably benign Het
Ros1 A G 10: 52,000,171 (GRCm39) V1118A possibly damaging Het
Sema3d A C 5: 12,634,923 (GRCm39) Y663S probably damaging Het
Serpina6 A G 12: 103,617,971 (GRCm39) W281R probably damaging Het
Slc8a3 A G 12: 81,246,332 (GRCm39) V900A probably damaging Het
Spats2l G T 1: 57,918,715 (GRCm39) V30L probably damaging Het
Spg21 A G 9: 65,383,231 (GRCm39) D139G probably damaging Het
Sun3 T C 11: 8,988,314 (GRCm39) T3A probably damaging Het
Tep1 A G 14: 51,066,456 (GRCm39) Y2335H probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Timd5 T A 11: 46,419,359 (GRCm39) D58E probably damaging Het
Timm21 C A 18: 84,967,539 (GRCm39) V112L possibly damaging Het
Tlk1 A T 2: 70,572,409 (GRCm39) N386K probably benign Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trgv1 T A 13: 19,524,401 (GRCm39) S42T probably benign Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ucp2 A T 7: 100,147,579 (GRCm39) N186I possibly damaging Het
Vmn1r119 A G 7: 20,746,245 (GRCm39) S46P probably benign Het
Vmn2r101 A T 17: 19,831,649 (GRCm39) probably null Het
Vmn2r105 T A 17: 20,428,676 (GRCm39) H800L probably damaging Het
Vmn2r69 T C 7: 85,060,367 (GRCm39) M406V possibly damaging Het
Vmn2r84 A G 10: 130,222,417 (GRCm39) L601P probably damaging Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Wap T C 11: 6,587,339 (GRCm39) probably benign Het
Wdr11 A G 7: 129,226,435 (GRCm39) I744M probably benign Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Zfp524 A T 7: 5,021,416 (GRCm39) I315F probably benign Het
Zfp62 T A 11: 49,106,556 (GRCm39) S216T probably damaging Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Other mutations in Manea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Manea APN 4 26,340,578 (GRCm39) missense probably damaging 1.00
IGL02066:Manea APN 4 26,340,965 (GRCm39) utr 5 prime probably benign
IGL02195:Manea APN 4 26,340,628 (GRCm39) nonsense probably null
IGL02527:Manea APN 4 26,336,619 (GRCm39) critical splice donor site probably null
IGL02727:Manea APN 4 26,328,127 (GRCm39) nonsense probably null
IGL02727:Manea APN 4 26,328,126 (GRCm39) missense probably damaging 1.00
R0099:Manea UTSW 4 26,328,104 (GRCm39) missense probably damaging 1.00
R0103:Manea UTSW 4 26,329,080 (GRCm39) splice site probably null
R0144:Manea UTSW 4 26,340,719 (GRCm39) missense probably benign 0.00
R0839:Manea UTSW 4 26,327,983 (GRCm39) missense probably damaging 1.00
R1998:Manea UTSW 4 26,327,871 (GRCm39) missense probably damaging 1.00
R1999:Manea UTSW 4 26,327,871 (GRCm39) missense probably damaging 1.00
R6621:Manea UTSW 4 26,340,363 (GRCm39) splice site probably null
R7113:Manea UTSW 4 26,336,718 (GRCm39) missense probably damaging 1.00
R7436:Manea UTSW 4 26,328,228 (GRCm39) missense probably damaging 1.00
R7553:Manea UTSW 4 26,327,986 (GRCm39) missense probably damaging 1.00
R7649:Manea UTSW 4 26,328,234 (GRCm39) missense probably damaging 1.00
R7680:Manea UTSW 4 26,340,649 (GRCm39) missense probably damaging 1.00
R7690:Manea UTSW 4 26,327,910 (GRCm39) missense probably benign 0.41
R7698:Manea UTSW 4 26,327,763 (GRCm39) missense probably damaging 1.00
R7699:Manea UTSW 4 26,340,758 (GRCm39) missense probably benign 0.03
R9568:Manea UTSW 4 26,340,468 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACAAAGAAACCCTCCTTTTC -3'
(R):5'- TAGTCATGTCGCCAGCTCTC -3'

Sequencing Primer
(F):5'- TGAGTTCCAAGTCAACCTGG -3'
(R):5'- CTCCACCGGCATCACTG -3'
Posted On 2016-06-06