Mutagenetix > Incidental Mutation

Incidental Mutation 'R5022:Rnf20'

389232

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

042613-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 49642016 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably benign
Transcript: ENSMUST00000029989

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably benign
Transcript: ENSMUST00000140341

SMART Domains

Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably benign
Transcript: ENSMUST00000156314

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167496

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGCATTTGTCTTAACAGAGATGAG -3'
(R):5'- CCAGAGCTACGAAGAATGGC -3'

Sequencing Primer
(F):5'- TGTCTTAACAGAGATGAGAATAGGTG -3'
(R):5'- GAGCTACGAAGAATGGCTGTTATTCC -3'

Posted On

2016-06-06