Mutagenetix > Incidental Mutation

Incidental Mutation 'R5022:Abca1'

389233

Institutional Source

Beutler Lab

Gene Symbol

Abca1

Ensembl Gene

ENSMUSG00000015243

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 1

Synonyms

ABC1

MMRRC Submission

042613-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5022 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

53030787-53159895 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

TCGACTGC to T at 53041570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000030010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030010]

AlphaFold

P41233

Predicted Effect

probably null
Transcript: ENSMUST00000030010

SMART Domains

Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
Pfam:ABC2_membrane_3	395	841	4.9e-14	PFAM
AAA	925	1122	4.2e-10	SMART
low complexity region	1137	1150	N/A	INTRINSIC
Pfam:ABC2_membrane_3	1344	1869	1.7e-53	PFAM
low complexity region	1890	1899	N/A	INTRINSIC
AAA	1938	2123	3.04e-7	SMART
low complexity region	2176	2187	N/A	INTRINSIC
low complexity region	2222	2237	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149127

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Abca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Abca1	APN	4	53059255	critical splice donor site	probably null
IGL00778:Abca1	APN	4	53086132	missense	probably benign
IGL01013:Abca1	APN	4	53038185	nonsense	probably null
IGL01510:Abca1	APN	4	53143979	missense	probably damaging	0.97
IGL01608:Abca1	APN	4	53038158	missense	probably damaging	1.00
IGL01845:Abca1	APN	4	53090297	missense	probably damaging	1.00
IGL02048:Abca1	APN	4	53069831	missense	probably damaging	1.00
IGL02249:Abca1	APN	4	53068739	nonsense	probably null
IGL02569:Abca1	APN	4	53034061	missense	probably damaging	1.00
IGL02622:Abca1	APN	4	53034046	missense	probably damaging	0.99
R6720_abca1_529	UTSW	4	53083733	missense	probably damaging	1.00
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0042:Abca1	UTSW	4	53059245	splice site	probably benign
R0050:Abca1	UTSW	4	53069910	splice site	probably benign
R0107:Abca1	UTSW	4	53080834	missense	probably benign	0.00
R0127:Abca1	UTSW	4	53067155	missense	probably benign	0.00
R0178:Abca1	UTSW	4	53081953	missense	possibly damaging	0.89
R0207:Abca1	UTSW	4	53086039	missense	probably damaging	0.97
R0267:Abca1	UTSW	4	53046105	missense	probably damaging	1.00
R0269:Abca1	UTSW	4	53044228	missense	probably benign
R0586:Abca1	UTSW	4	53092860	missense	probably benign	0.00
R0587:Abca1	UTSW	4	53107035	missense	probably benign	0.00
R1403:Abca1	UTSW	4	53059253	splice site	probably benign
R1404:Abca1	UTSW	4	53059253	splice site	probably benign
R1405:Abca1	UTSW	4	53059253	splice site	probably benign
R1558:Abca1	UTSW	4	53092887	missense	probably null	0.00
R1655:Abca1	UTSW	4	53050964	missense	probably benign
R1662:Abca1	UTSW	4	53090251	splice site	probably null
R1769:Abca1	UTSW	4	53074325	missense	probably damaging	1.00
R1898:Abca1	UTSW	4	53071977	missense	probably benign	0.08
R1945:Abca1	UTSW	4	53061509	frame shift	probably null
R1966:Abca1	UTSW	4	53050409	missense	probably damaging	1.00
R2055:Abca1	UTSW	4	53069881	missense	probably benign
R2185:Abca1	UTSW	4	53089830	missense	probably benign	0.12
R2202:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2203:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R2204:Abca1	UTSW	4	53090291	missense	probably damaging	0.96
R3056:Abca1	UTSW	4	53127626	missense	probably benign
R3849:Abca1	UTSW	4	53061481	splice site	probably benign
R3850:Abca1	UTSW	4	53061481	splice site	probably benign
R3906:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R3908:Abca1	UTSW	4	53067151	missense	possibly damaging	0.84
R4050:Abca1	UTSW	4	53044144	missense	probably damaging	1.00
R4204:Abca1	UTSW	4	53090369	missense	probably benign	0.00
R4225:Abca1	UTSW	4	53085106	missense	possibly damaging	0.87
R4577:Abca1	UTSW	4	53062568	missense	possibly damaging	0.94
R4979:Abca1	UTSW	4	53085092	splice site	probably null
R5168:Abca1	UTSW	4	53086070	missense	probably benign
R5363:Abca1	UTSW	4	53132963	missense	probably benign	0.00
R5439:Abca1	UTSW	4	53042381	missense	possibly damaging	0.55
R5604:Abca1	UTSW	4	53067168	splice site	probably null
R5614:Abca1	UTSW	4	53046132	missense	probably damaging	1.00
R5810:Abca1	UTSW	4	53079631	missense	probably benign
R6001:Abca1	UTSW	4	53075555	missense	possibly damaging	0.68
R6151:Abca1	UTSW	4	53085261	missense	probably benign
R6185:Abca1	UTSW	4	53078089	missense	probably benign	0.31
R6262:Abca1	UTSW	4	53092917	missense	probably benign	0.01
R6455:Abca1	UTSW	4	53042376	missense	probably damaging	0.98
R6472:Abca1	UTSW	4	53085991	critical splice donor site	probably null
R6564:Abca1	UTSW	4	53034031	missense	possibly damaging	0.85
R6720:Abca1	UTSW	4	53083733	missense	probably damaging	1.00
R6903:Abca1	UTSW	4	53143952	missense	probably benign	0.17
R6960:Abca1	UTSW	4	53072924	missense	probably benign	0.00
R7065:Abca1	UTSW	4	53074233	missense	probably damaging	0.98
R7142:Abca1	UTSW	4	53082050	missense	probably damaging	1.00
R7322:Abca1	UTSW	4	53067151	missense	probably damaging	0.97
R7520:Abca1	UTSW	4	53078114	missense	probably benign
R7547:Abca1	UTSW	4	53109269	missense	probably benign	0.02
R7793:Abca1	UTSW	4	53042367	missense	not run
R7863:Abca1	UTSW	4	53107179	missense	probably benign
R7877:Abca1	UTSW	4	53046135	missense	possibly damaging	0.55
R8010:Abca1	UTSW	4	53127600	missense	probably benign
R8058:Abca1	UTSW	4	53081954	missense	possibly damaging	0.60
R8181:Abca1	UTSW	4	53059303	missense	probably benign	0.21
R8471:Abca1	UTSW	4	53044187	missense	probably damaging	1.00
R8774:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8774-TAIL:Abca1	UTSW	4	53090358	missense	possibly damaging	0.89
R8806:Abca1	UTSW	4	53084520	missense	probably benign	0.17
R8841:Abca1	UTSW	4	53143925	splice site	probably benign
R9081:Abca1	UTSW	4	53109162	critical splice donor site	probably null
R9483:Abca1	UTSW	4	53060351	missense	probably benign	0.11
R9532:Abca1	UTSW	4	53109284	missense	probably benign
R9621:Abca1	UTSW	4	53092918	missense	probably benign	0.00
R9638:Abca1	UTSW	4	53092806	missense	probably damaging	0.96
RF005:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
RF024:Abca1	UTSW	4	53049125	missense	probably damaging	0.97
X0023:Abca1	UTSW	4	53049038	missense	possibly damaging	0.91
Z1177:Abca1	UTSW	4	53079584	missense	probably benign	0.00
Z1177:Abca1	UTSW	4	53080799	missense	probably benign	0.01
Z1177:Abca1	UTSW	4	53086133	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACACAAGAGGTTCTCATTCTCTC -3'
(R):5'- AGGCTACTCATTGCGGAGAC -3'

Sequencing Primer
(F):5'- AAGAGGTTCTCATTCTCTCCACGAC -3'
(R):5'- AGAAAGGTTCTTGGCACATCTG -3'

Posted On

2016-06-06