Mutagenetix > Incidental Mutations

Incidental Mutation 'R5022:Cd163'

389244

Institutional Source

Beutler Lab

Gene Symbol

Cd163

Ensembl Gene

ENSMUSG00000008845

Gene Name

CD163 antigen

Synonyms

MMRRC Submission

042613-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124304656-124330527 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124325288 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 937 (T937I)

Ref Sequence

ENSEMBL: ENSMUSP00000108160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032234
AA Change: T937I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: T937I

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
SR	50	150	1.1e-52	SMART
SR	157	258	1.4e-55	SMART
SR	265	365	7.3e-60	SMART
SR	372	472	1.2e-35	SMART
SR	477	577	2.3e-41	SMART
SR	582	682	9.8e-39	SMART
SR	719	819	1.1e-60	SMART
SR	824	927	4e-24	SMART
SR	930	1030	2.3e-55	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112541
AA Change: T937I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: T937I

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
SR	50	150	2.26e-50	SMART
SR	157	258	3.11e-53	SMART
SR	265	365	1.54e-57	SMART
SR	372	472	2.64e-33	SMART
SR	477	577	5.03e-39	SMART
SR	582	682	2.09e-36	SMART
SR	719	819	2.38e-58	SMART
SR	824	927	8.93e-22	SMART
SR	930	1030	5.06e-53	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203210

Meta Mutation Damage Score

0.3275

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Cd163

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Cd163	APN	6	124329101	splice site	probably benign
IGL00755:Cd163	APN	6	124318657	missense	possibly damaging	0.70
IGL01690:Cd163	APN	6	124307318	missense	possibly damaging	0.89
IGL02101:Cd163	APN	6	124307287	nonsense	probably null
IGL02733:Cd163	APN	6	124325341	missense	probably damaging	1.00
IGL02801:Cd163	APN	6	124320529	missense	probably benign	0.00
IGL02897:Cd163	APN	6	124325527	missense	probably damaging	1.00
IGL03074:Cd163	APN	6	124317986	missense	probably benign	0.00
IGL03283:Cd163	APN	6	124309199	missense	possibly damaging	0.49
compass	UTSW	6	124329086	makesense	probably null
hottish	UTSW	6	124309208	missense	probably damaging	1.00
protractor	UTSW	6	124311566	missense	probably damaging	1.00
t-square	UTSW	6	124325288	missense	probably damaging	0.97
R0494:Cd163	UTSW	6	124311449	missense	probably damaging	1.00
R0554:Cd163	UTSW	6	124312660	missense	probably benign	0.03
R0622:Cd163	UTSW	6	124317352	missense	probably damaging	1.00
R1004:Cd163	UTSW	6	124325347	missense	probably damaging	1.00
R1061:Cd163	UTSW	6	124309169	missense	probably benign	0.00
R1132:Cd163	UTSW	6	124309096	nonsense	probably null
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1436:Cd163	UTSW	6	124327931	missense	possibly damaging	0.47
R1463:Cd163	UTSW	6	124311447	missense	probably damaging	1.00
R1532:Cd163	UTSW	6	124312730	missense	possibly damaging	0.91
R1541:Cd163	UTSW	6	124327961	missense	probably benign
R1654:Cd163	UTSW	6	124317581	missense	probably damaging	1.00
R1717:Cd163	UTSW	6	124329588	utr 3 prime	probably benign
R1744:Cd163	UTSW	6	124307028	missense	possibly damaging	0.94
R2014:Cd163	UTSW	6	124325498	missense	probably damaging	0.99
R2035:Cd163	UTSW	6	124320629	missense	probably damaging	0.97
R2095:Cd163	UTSW	6	124317822	missense	probably damaging	1.00
R2124:Cd163	UTSW	6	124318856	missense	probably damaging	1.00
R2146:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R2353:Cd163	UTSW	6	124319156	nonsense	probably null
R3854:Cd163	UTSW	6	124311566	missense	probably damaging	1.00
R4425:Cd163	UTSW	6	124327903	missense	possibly damaging	0.94
R4631:Cd163	UTSW	6	124329086	makesense	probably null
R4647:Cd163	UTSW	6	124320621	missense	probably damaging	1.00
R4713:Cd163	UTSW	6	124317618	critical splice donor site	probably null
R4803:Cd163	UTSW	6	124312430	missense	probably damaging	0.99
R4996:Cd163	UTSW	6	124319147	missense	probably benign	0.00
R5023:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5032:Cd163	UTSW	6	124311669	missense	probably damaging	1.00
R5057:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5121:Cd163	UTSW	6	124317989	missense	probably damaging	1.00
R5436:Cd163	UTSW	6	124327964	missense	probably benign
R5453:Cd163	UTSW	6	124312541	missense	probably damaging	1.00
R5723:Cd163	UTSW	6	124319063	missense	probably benign	0.00
R5929:Cd163	UTSW	6	124326609	critical splice donor site	probably null
R5943:Cd163	UTSW	6	124329602	makesense	probably null
R5964:Cd163	UTSW	6	124326572	missense	probably benign	0.01
R5966:Cd163	UTSW	6	124320636	nonsense	probably null
R6279:Cd163	UTSW	6	124317991	nonsense	probably null
R6300:Cd163	UTSW	6	124317991	nonsense	probably null
R6499:Cd163	UTSW	6	124304744	missense	probably benign	0.00
R6602:Cd163	UTSW	6	124311635	missense	probably damaging	1.00
R6708:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R6767:Cd163	UTSW	6	124304779	missense	possibly damaging	0.56
R6979:Cd163	UTSW	6	124317986	missense	probably benign	0.00
R6993:Cd163	UTSW	6	124317714	missense	probably damaging	1.00
R7345:Cd163	UTSW	6	124318938	missense	possibly damaging	0.52
R7382:Cd163	UTSW	6	124311312	splice site	probably null
R7552:Cd163	UTSW	6	124307228	missense	probably benign	0.08
R7829:Cd163	UTSW	6	124304779	missense	probably benign	0.04
R8354:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8454:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8530:Cd163	UTSW	6	124318901	missense	probably damaging	1.00
R8560:Cd163	UTSW	6	124317401	missense	possibly damaging	0.86
R8878:Cd163	UTSW	6	124320510	missense	probably damaging	0.99
Z1177:Cd163	UTSW	6	124317385	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CCGAGCCTTAGAAGAGAGGAGTG -3'
(R):5'- CCGCCTTTGCTACTAAAGAGTCC -3'

Sequencing Primer
(F):5'- ATGGCTGTTACTCTCTACAC -3'
(R):5'- CAGCTCAATCCAGGTTGTTG -3'

Posted On

2016-06-06