Mutagenetix > Incidental Mutations

Incidental Mutation 'R5022:Ros1'

389264

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

MMRRC Submission

042613-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R5022 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52124075 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1118 (V1118A)

Ref Sequence

ENSEMBL: ENSMUSP00000151615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably benign
Transcript: ENSMUST00000020045
AA Change: V1139A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: V1139A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117992
AA Change: V1118A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: V1118A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177378
AA Change: V1118A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: V1118A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177387

Predicted Effect

probably benign
Transcript: ENSMUST00000218452
AA Change: V1118A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219173
AA Change: V1118A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000219692

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
boss	UTSW	10	52090995	nonsense	probably null
Chuckwagon	UTSW	10	52118203	missense	probably damaging	1.00
trail	UTSW	10	52161895	nonsense	probably null
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0599:Ros1	UTSW	10	52123300	missense	probably damaging	1.00
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R1794:Ros1	UTSW	10	52124103	nonsense	probably null
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	splice site	probably null
R3424:Ros1	UTSW	10	52128416	splice site	probably null
R3425:Ros1	UTSW	10	52128416	splice site	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7355:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
R7832:Ros1	UTSW	10	52144861	missense	probably damaging	0.99
R7854:Ros1	UTSW	10	52128467	missense	probably damaging	1.00
R7912:Ros1	UTSW	10	52168695	missense	probably damaging	1.00
R7972:Ros1	UTSW	10	52154830	nonsense	probably null
R7993:Ros1	UTSW	10	52123347	missense	probably benign	0.34
R8036:Ros1	UTSW	10	52165343	missense	probably benign
R8137:Ros1	UTSW	10	52125837	missense	possibly damaging	0.87
R8169:Ros1	UTSW	10	52064672	critical splice donor site	probably null
R8199:Ros1	UTSW	10	52101717	nonsense	probably null
R8293:Ros1	UTSW	10	52087918	missense	probably damaging	1.00
R8368:Ros1	UTSW	10	52064737	missense	probably damaging	1.00
R8406:Ros1	UTSW	10	52101845	missense	possibly damaging	0.56
RF018:Ros1	UTSW	10	52155121	missense	probably benign
Z1176:Ros1	UTSW	10	52091109	missense	possibly damaging	0.89
Z1177:Ros1	UTSW	10	52168671	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGACCCTAAGTTTCCTCAAGCTAC -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- CTCAAGCTACTTCGGTGTGAGAAAAC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'

Posted On

2016-06-06