Mutagenetix > Incidental Mutations

Incidental Mutation 'R5022:Ros1'

389264

Institutional Source

Beutler Lab

Gene Symbol

Ros1

Ensembl Gene

ENSMUSG00000019893

Gene Name

Ros1 proto-oncogene

Synonyms

Ros-1, c-ros

MMRRC Submission

042613-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R5022 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

52045721-52195244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52124075 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1118 (V1118A)

Ref Sequence

ENSEMBL: ENSMUSP00000151615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]

Predicted Effect

probably benign
Transcript: ENSMUST00000020045
AA Change: V1139A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: V1139A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	568	654	2.24e-4	SMART
LY	734	776	2.28e1	SMART
LY	777	815	4.61e0	SMART
FN3	944	1023	5.53e-4	SMART
FN3	1037	1133	1.07e1	SMART
FN3	1440	1532	1.19e1	SMART
FN3	1551	1637	2.11e0	SMART
FN3	1649	1731	6.8e-4	SMART
FN3	1746	1832	2.7e1	SMART
TyrKc	1938	2208	1.3e-145	SMART
low complexity region	2294	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117992
AA Change: V1118A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: V1118A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
TyrKc	1917	2187	1.3e-145	SMART
low complexity region	2273	2286	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177378
AA Change: V1118A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: V1118A

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
FN3	109	187	1.05e-4	SMART
FN3	205	282	7.45e-10	SMART
LY	369	409	9.17e0	SMART
FN3	547	633	2.24e-4	SMART
LY	713	755	2.28e1	SMART
LY	756	794	4.61e0	SMART
FN3	923	1002	5.53e-4	SMART
FN3	1016	1112	1.07e1	SMART
Blast:LY	1190	1236	2e-18	BLAST
FN3	1419	1511	1.19e1	SMART
FN3	1530	1616	2.11e0	SMART
FN3	1628	1710	6.8e-4	SMART
FN3	1725	1811	2.7e1	SMART
transmembrane domain	1832	1854	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177387

Predicted Effect

probably benign
Transcript: ENSMUST00000218452
AA Change: V1118A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219173
AA Change: V1118A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000219692

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Ros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ros1	APN	10	52194890	missense	probably benign	0.01
IGL00338:Ros1	APN	10	52125811	missense	probably benign
IGL00419:Ros1	APN	10	52091054	missense	probably damaging	0.97
IGL00840:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00841:Ros1	APN	10	52144873	missense	possibly damaging	0.92
IGL00951:Ros1	APN	10	52143252	missense	probably damaging	0.99
IGL01123:Ros1	APN	10	52120809	missense	probably damaging	1.00
IGL01128:Ros1	APN	10	52142328	nonsense	probably null
IGL01300:Ros1	APN	10	52101713	missense	probably benign	0.01
IGL01316:Ros1	APN	10	52087879	critical splice donor site	probably null
IGL01349:Ros1	APN	10	52051026	missense	probably damaging	0.99
IGL01363:Ros1	APN	10	52166142	missense	probably damaging	1.00
IGL01457:Ros1	APN	10	52046330	splice site	probably benign
IGL01532:Ros1	APN	10	52090938	splice site	probably benign
IGL01585:Ros1	APN	10	52155102	missense	probably damaging	1.00
IGL01650:Ros1	APN	10	52154979	missense	probably damaging	0.99
IGL01672:Ros1	APN	10	52101803	missense	possibly damaging	0.92
IGL01904:Ros1	APN	10	52077911	missense	probably damaging	0.97
IGL02040:Ros1	APN	10	52115922	missense	probably damaging	0.99
IGL02053:Ros1	APN	10	52162720	missense	probably damaging	1.00
IGL02147:Ros1	APN	10	52120895	missense	probably damaging	1.00
IGL02169:Ros1	APN	10	52081957	critical splice donor site	probably null
IGL02247:Ros1	APN	10	52129581	missense	probably damaging	0.99
IGL02262:Ros1	APN	10	52178969	missense	probably damaging	0.96
IGL02307:Ros1	APN	10	52128438	missense	possibly damaging	0.53
IGL02398:Ros1	APN	10	52144884	splice site	probably benign
IGL02525:Ros1	APN	10	52116042	missense	possibly damaging	0.66
IGL02718:Ros1	APN	10	52118232	missense	probably damaging	1.00
IGL02721:Ros1	APN	10	52172831	splice site	probably benign
IGL02808:Ros1	APN	10	52125889	missense	probably damaging	1.00
IGL03009:Ros1	APN	10	52145907	missense	probably benign	0.00
IGL03035:Ros1	APN	10	52075984	splice site	probably benign
IGL03092:Ros1	APN	10	52098806	missense	probably damaging	0.99
IGL03309:Ros1	APN	10	52118261	missense	possibly damaging	0.83
IGL03333:Ros1	APN	10	52155171	missense	probably damaging	1.00
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0049:Ros1	UTSW	10	52101761	missense	possibly damaging	0.66
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0050:Ros1	UTSW	10	52101803	missense	probably damaging	0.97
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0057:Ros1	UTSW	10	52180191	missense	probably benign	0.00
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0106:Ros1	UTSW	10	52142267	missense	possibly damaging	0.85
R0125:Ros1	UTSW	10	52125789	missense	probably benign	0.38
R0403:Ros1	UTSW	10	52143438	splice site	probably benign
R0487:Ros1	UTSW	10	52155108	missense	possibly damaging	0.69
R0502:Ros1	UTSW	10	52194823	splice site	probably benign
R0557:Ros1	UTSW	10	52085263	missense	possibly damaging	0.82
R0599:Ros1	UTSW	10	52123300	missense	probably damaging	1.00
R0620:Ros1	UTSW	10	52118348	missense	probably damaging	1.00
R0679:Ros1	UTSW	10	52066295	missense	possibly damaging	0.95
R1005:Ros1	UTSW	10	52128405	splice site	probably benign
R1073:Ros1	UTSW	10	52046125	missense	probably damaging	1.00
R1220:Ros1	UTSW	10	52098870	missense	probably damaging	0.97
R1279:Ros1	UTSW	10	52142166	missense	possibly damaging	0.81
R1295:Ros1	UTSW	10	52087932	missense	possibly damaging	0.92
R1336:Ros1	UTSW	10	52168662	missense	probably damaging	1.00
R1371:Ros1	UTSW	10	52087945	missense	probably damaging	0.98
R1447:Ros1	UTSW	10	52098858	missense	possibly damaging	0.66
R1486:Ros1	UTSW	10	52172858	missense	probably damaging	1.00
R1499:Ros1	UTSW	10	52098677	missense	possibly damaging	0.92
R1669:Ros1	UTSW	10	52161811	missense	probably damaging	1.00
R1744:Ros1	UTSW	10	52123379	missense	probably damaging	0.99
R1759:Ros1	UTSW	10	52120826	missense	probably damaging	1.00
R1791:Ros1	UTSW	10	52100087	missense	probably benign	0.00
R1794:Ros1	UTSW	10	52124103	nonsense	probably null
R2031:Ros1	UTSW	10	52067068	missense	possibly damaging	0.88
R2115:Ros1	UTSW	10	52128555	missense	probably benign	0.00
R2219:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R2290:Ros1	UTSW	10	52118381	missense	probably damaging	0.96
R2329:Ros1	UTSW	10	52162887	missense	probably damaging	1.00
R2371:Ros1	UTSW	10	52163895	missense	possibly damaging	0.66
R2879:Ros1	UTSW	10	52172840	critical splice donor site	probably null
R3154:Ros1	UTSW	10	52050981	missense	probably benign
R3423:Ros1	UTSW	10	52128416	unclassified	probably null
R3424:Ros1	UTSW	10	52128416	unclassified	probably null
R3425:Ros1	UTSW	10	52128416	unclassified	probably null
R3433:Ros1	UTSW	10	52091108	missense	probably benign	0.45
R3522:Ros1	UTSW	10	52090995	nonsense	probably null
R3686:Ros1	UTSW	10	52145816	missense	probably damaging	1.00
R3710:Ros1	UTSW	10	52161895	nonsense	probably null
R3771:Ros1	UTSW	10	52128991	missense	probably damaging	0.97
R3808:Ros1	UTSW	10	52120848	missense	probably benign	0.08
R3930:Ros1	UTSW	10	52194848	missense	possibly damaging	0.92
R3950:Ros1	UTSW	10	52066388	missense	probably damaging	1.00
R3981:Ros1	UTSW	10	52120878	missense	possibly damaging	0.46
R4007:Ros1	UTSW	10	52118232	missense	probably damaging	1.00
R4346:Ros1	UTSW	10	52168609	missense	possibly damaging	0.92
R4382:Ros1	UTSW	10	52120959	missense	possibly damaging	0.46
R4414:Ros1	UTSW	10	52162704	critical splice donor site	probably null
R4450:Ros1	UTSW	10	52077942	missense	probably damaging	0.98
R4468:Ros1	UTSW	10	52118356	missense	probably damaging	1.00
R4569:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R4649:Ros1	UTSW	10	52129668	missense	possibly damaging	0.66
R4684:Ros1	UTSW	10	52129096	missense	probably damaging	1.00
R4706:Ros1	UTSW	10	52101894	missense	possibly damaging	0.95
R4731:Ros1	UTSW	10	52142229	missense	probably damaging	1.00
R4748:Ros1	UTSW	10	52115997	missense	probably benign	0.00
R4806:Ros1	UTSW	10	52096175	missense	probably damaging	0.96
R4865:Ros1	UTSW	10	52172870	missense	probably damaging	0.99
R4973:Ros1	UTSW	10	52154991	missense	probably damaging	0.98
R5033:Ros1	UTSW	10	52128416	critical splice donor site	probably null
R5082:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5083:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5130:Ros1	UTSW	10	52163941	missense	possibly damaging	0.66
R5269:Ros1	UTSW	10	52051008	missense	probably damaging	1.00
R5399:Ros1	UTSW	10	52090944	critical splice donor site	probably null
R5414:Ros1	UTSW	10	52155093	missense	probably damaging	1.00
R5659:Ros1	UTSW	10	52143386	missense	possibly damaging	0.92
R5742:Ros1	UTSW	10	52142138	critical splice donor site	probably null
R5780:Ros1	UTSW	10	52194857	missense	probably damaging	1.00
R5805:Ros1	UTSW	10	52123289	missense	probably damaging	1.00
R5843:Ros1	UTSW	10	52166197	missense	possibly damaging	0.92
R5881:Ros1	UTSW	10	52181798	missense	probably benign	0.26
R6027:Ros1	UTSW	10	52163968	missense	possibly damaging	0.82
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6035:Ros1	UTSW	10	52077971	missense	probably benign
R6052:Ros1	UTSW	10	52163903	missense	probably benign	0.39
R6175:Ros1	UTSW	10	52101785	missense	probably benign	0.02
R6315:Ros1	UTSW	10	52118210	missense	probably benign
R6342:Ros1	UTSW	10	52155255	missense	probably damaging	1.00
R6470:Ros1	UTSW	10	52166044	critical splice donor site	probably null
R6527:Ros1	UTSW	10	52143377	missense	possibly damaging	0.66
R6568:Ros1	UTSW	10	52162812	missense	probably damaging	1.00
R6573:Ros1	UTSW	10	52155010	missense	possibly damaging	0.84
R6653:Ros1	UTSW	10	52142203	missense	probably damaging	1.00
R6959:Ros1	UTSW	10	52163994	missense	probably damaging	0.99
R7011:Ros1	UTSW	10	52180176	missense	probably damaging	1.00
R7111:Ros1	UTSW	10	52181810	missense	probably benign	0.02
R7243:Ros1	UTSW	10	52123381	missense	probably damaging	1.00
R7355:Ros1	UTSW	10	52166079	missense	probably damaging	1.00
R7385:Ros1	UTSW	10	52155126	missense	probably benign	0.00
R7460:Ros1	UTSW	10	52118203	missense	probably damaging	1.00
R7549:Ros1	UTSW	10	52145834	missense	probably damaging	0.96
R7573:Ros1	UTSW	10	52169976	missense	probably benign	0.03
R7650:Ros1	UTSW	10	52046209	missense	probably benign	0.00
R7667:Ros1	UTSW	10	52163971	missense	probably damaging	1.00
R7696:Ros1	UTSW	10	52142283	missense	probably damaging	1.00
R7785:Ros1	UTSW	10	52162848	missense	probably damaging	1.00
R7814:Ros1	UTSW	10	52096137	missense	probably benign	0.28
R7830:Ros1	UTSW	10	52154934	missense	probably damaging	0.99
RF018:Ros1	UTSW	10	52155121	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGACCCTAAGTTTCCTCAAGCTAC -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- CTCAAGCTACTTCGGTGTGAGAAAAC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'

Posted On

2016-06-06