Incidental Mutation 'R5022:Ros1'
ID389264
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 042613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R5022 (G1)
Quality Score185
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52124075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1118 (V1118A)
Ref Sequence ENSEMBL: ENSMUSP00000151615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably benign
Transcript: ENSMUST00000020045
AA Change: V1139A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: V1139A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117992
AA Change: V1118A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: V1118A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177378
AA Change: V1118A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: V1118A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177387
Predicted Effect probably benign
Transcript: ENSMUST00000218452
AA Change: V1118A

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219173
AA Change: V1118A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 probably null Het
Abca15 T C 7: 120,346,096 I465T probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcb4 T A 5: 8,909,054 probably null Het
Acan T C 7: 79,092,808 probably null Het
Aebp2 G A 6: 140,637,730 R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 probably null Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
AW551984 A T 9: 39,597,965 N293K probably benign Het
BC028528 T A 3: 95,888,823 probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Birc6 A G 17: 74,692,332 Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 R369G probably damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Ccdc148 G A 2: 58,827,632 A453V probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Celf2 C T 2: 6,607,847 probably benign Het
Chga T C 12: 102,562,837 W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Crim1 T C 17: 78,280,129 V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 S116T probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 L355Q probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fbln1 G A 15: 85,237,626 S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fn1 T C 1: 71,624,179 Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 I2031V probably benign Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gm5420 A T 10: 21,691,727 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gm7104 A T 12: 88,285,759 noncoding transcript Het
Gp2 A G 7: 119,449,114 I427T probably damaging Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpr142 A C 11: 114,804,388 S60R probably benign Het
Helz2 T C 2: 181,240,569 R144G probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Irs2 A C 8: 10,987,012 *1322G probably null Het
Keg1 A G 19: 12,719,157 N288S probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Klhl1 G A 14: 96,136,706 P635S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Manea A T 4: 26,336,630 Y215* probably null Het
Mdga2 C T 12: 66,470,760 C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 M582K probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 Y239H probably damaging Het
Nat8 G A 6: 85,830,857 T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 M92I probably benign Het
Olfr164 A T 16: 19,286,059 V228D probably damaging Het
Olfr239 T C 17: 33,199,777 F239S probably damaging Het
Olfr457 A T 6: 42,471,287 V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 P4L probably benign Het
Olfr727 T C 14: 50,127,012 V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 N776K probably benign Het
Pip5k1c G A 10: 81,310,889 probably null Het
Plk4 G A 3: 40,802,077 probably null Het
Prmt8 A G 6: 127,711,163 Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 probably benign Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 P312S possibly damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rai14 A G 15: 10,574,506 S789P probably damaging Het
Rbm26 C T 14: 105,144,252 D486N probably damaging Het
Rnf20 A G 4: 49,642,016 probably benign Het
Sema3d A C 5: 12,584,956 Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Spats2l G T 1: 57,879,556 V30L probably damaging Het
Spg21 A G 9: 65,475,949 D139G probably damaging Het
Sun3 T C 11: 9,038,314 T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 S42T probably benign Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 N386K probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ucp2 A T 7: 100,498,372 N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 probably null Het
Vmn2r105 T A 17: 20,208,414 H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 L601P probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Wap T C 11: 6,637,339 probably benign Het
Wdr11 A G 7: 129,624,711 I744M probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
RF018:Ros1 UTSW 10 52155121 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCCTAAGTTTCCTCAAGCTAC -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- CTCAAGCTACTTCGGTGTGAGAAAAC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'
Posted On2016-06-06