Incidental Mutation 'R5022:Bicc1'
ID389265
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 042613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5022 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70947883 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 393 (S393P)
Ref Sequence ENSEMBL: ENSMUSP00000119137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014473
AA Change: S475P

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: S475P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131445
AA Change: S393P

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: S393P

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143791
AA Change: S475P

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: S475P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Meta Mutation Damage Score 0.1165 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 probably null Het
Abca15 T C 7: 120,346,096 I465T probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcb4 T A 5: 8,909,054 probably null Het
Acan T C 7: 79,092,808 probably null Het
Aebp2 G A 6: 140,637,730 R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 probably null Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
AW551984 A T 9: 39,597,965 N293K probably benign Het
BC028528 T A 3: 95,888,823 probably benign Het
Birc6 A G 17: 74,692,332 Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 R369G probably damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Ccdc148 G A 2: 58,827,632 A453V probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Celf2 C T 2: 6,607,847 probably benign Het
Chga T C 12: 102,562,837 W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Crim1 T C 17: 78,280,129 V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 S116T probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 L355Q probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fbln1 G A 15: 85,237,626 S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fn1 T C 1: 71,624,179 Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 I2031V probably benign Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gm5420 A T 10: 21,691,727 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gm7104 A T 12: 88,285,759 noncoding transcript Het
Gp2 A G 7: 119,449,114 I427T probably damaging Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpr142 A C 11: 114,804,388 S60R probably benign Het
Helz2 T C 2: 181,240,569 R144G probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Irs2 A C 8: 10,987,012 *1322G probably null Het
Keg1 A G 19: 12,719,157 N288S probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Klhl1 G A 14: 96,136,706 P635S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Manea A T 4: 26,336,630 Y215* probably null Het
Mdga2 C T 12: 66,470,760 C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 M582K probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 Y239H probably damaging Het
Nat8 G A 6: 85,830,857 T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 M92I probably benign Het
Olfr164 A T 16: 19,286,059 V228D probably damaging Het
Olfr239 T C 17: 33,199,777 F239S probably damaging Het
Olfr457 A T 6: 42,471,287 V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 P4L probably benign Het
Olfr727 T C 14: 50,127,012 V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 N776K probably benign Het
Pip5k1c G A 10: 81,310,889 probably null Het
Plk4 G A 3: 40,802,077 probably null Het
Prmt8 A G 6: 127,711,163 Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 probably benign Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 P312S possibly damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rai14 A G 15: 10,574,506 S789P probably damaging Het
Rbm26 C T 14: 105,144,252 D486N probably damaging Het
Rnf20 A G 4: 49,642,016 probably benign Het
Ros1 A G 10: 52,124,075 V1118A possibly damaging Het
Sema3d A C 5: 12,584,956 Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Spats2l G T 1: 57,879,556 V30L probably damaging Het
Spg21 A G 9: 65,475,949 D139G probably damaging Het
Sun3 T C 11: 9,038,314 T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 S42T probably benign Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 N386K probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ucp2 A T 7: 100,498,372 N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 probably null Het
Vmn2r105 T A 17: 20,208,414 H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 L601P probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Wap T C 11: 6,637,339 probably benign Het
Wdr11 A G 7: 129,624,711 I744M probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGCTAGAGGATGCAGTC -3'
(R):5'- TCGAATGTGACAGATTAGAAAGCAC -3'

Sequencing Primer
(F):5'- CACTTGAAGAAATGGGATCCCTTG -3'
(R):5'- AGCACCAGGTTCTATCGATG -3'
Posted On2016-06-06