Mutagenetix > Incidental Mutation

Incidental Mutation 'R5022:Trappc10'

389266

Institutional Source

Beutler Lab

Gene Symbol

Trappc10

Ensembl Gene

ENSMUSG00000000374

Gene Name

trafficking protein particle complex 10

Synonyms

Tmem1, LOC380642, B230307C21Rik

MMRRC Submission

042613-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5022 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78186725-78244641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78217160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 260 (F260L)

Ref Sequence

ENSEMBL: ENSMUSP00000000384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000217980]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000384
AA Change: F260L

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: F260L

Domain	Start	End	E-Value	Type
Pfam:TRAPPC10	1016	1245	1.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217980

Meta Mutation Damage Score

0.2354

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Slc8a3	A	G	12: 81,199,558	V900A	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Trappc10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Trappc10	APN	10	78203877	splice site	probably benign
IGL01375:Trappc10	APN	10	78188899	missense	possibly damaging	0.75
IGL01413:Trappc10	APN	10	78197844	missense	possibly damaging	0.87
IGL02413:Trappc10	APN	10	78210776	missense	probably damaging	0.99
IGL03037:Trappc10	APN	10	78199035	unclassified	probably benign
IGL03094:Trappc10	APN	10	78228920	splice site	probably benign
IGL03164:Trappc10	APN	10	78220242	missense	probably damaging	1.00
IGL03351:Trappc10	APN	10	78188761	missense	probably damaging	1.00
IGL03055:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
IGL03098:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
R0304:Trappc10	UTSW	10	78210760	splice site	probably benign
R0605:Trappc10	UTSW	10	78201497	missense	possibly damaging	0.70
R1806:Trappc10	UTSW	10	78210776	missense	probably damaging	0.99
R1856:Trappc10	UTSW	10	78196451	missense	probably benign	0.00
R2045:Trappc10	UTSW	10	78209479	splice site	probably benign
R2088:Trappc10	UTSW	10	78196334	missense	probably benign	0.00
R2126:Trappc10	UTSW	10	78203924	missense	possibly damaging	0.94
R2202:Trappc10	UTSW	10	78199042	critical splice donor site	probably null
R2509:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2510:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2511:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2893:Trappc10	UTSW	10	78193401	missense	probably benign	0.00
R3744:Trappc10	UTSW	10	78199090	missense	probably benign	0.00
R3778:Trappc10	UTSW	10	78200802	missense	possibly damaging	0.89
R3876:Trappc10	UTSW	10	78220186	splice site	probably null
R3930:Trappc10	UTSW	10	78210403	missense	probably benign	0.03
R4078:Trappc10	UTSW	10	78210382	missense	probably damaging	1.00
R4111:Trappc10	UTSW	10	78196430	missense	probably benign	0.09
R4418:Trappc10	UTSW	10	78217188	missense	probably damaging	1.00
R4549:Trappc10	UTSW	10	78231458	missense	probably damaging	1.00
R4695:Trappc10	UTSW	10	78197863	missense	probably damaging	0.99
R4799:Trappc10	UTSW	10	78201590	missense	possibly damaging	0.71
R5023:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5026:Trappc10	UTSW	10	78204288	missense	possibly damaging	0.82
R5057:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5282:Trappc10	UTSW	10	78187860	missense	probably damaging	1.00
R5363:Trappc10	UTSW	10	78188840	missense	possibly damaging	0.92
R5813:Trappc10	UTSW	10	78222739	missense	probably damaging	1.00
R5831:Trappc10	UTSW	10	78209426	missense	probably damaging	1.00
R6209:Trappc10	UTSW	10	78214812	missense	possibly damaging	0.50
R6450:Trappc10	UTSW	10	78209450	missense	possibly damaging	0.92
R6520:Trappc10	UTSW	10	78201453	missense	probably benign	0.00
R6533:Trappc10	UTSW	10	78188894	missense	probably damaging	0.96
R6767:Trappc10	UTSW	10	78193511	missense	possibly damaging	0.75
R6798:Trappc10	UTSW	10	78188831	missense	probably benign	0.00
R7205:Trappc10	UTSW	10	78210428	missense	probably damaging	1.00
R7282:Trappc10	UTSW	10	78207493	missense	probably damaging	0.98
R7378:Trappc10	UTSW	10	78193418	missense	probably damaging	0.96
R7384:Trappc10	UTSW	10	78209384	missense	possibly damaging	0.85
R7770:Trappc10	UTSW	10	78210845	missense	probably damaging	0.96
R7829:Trappc10	UTSW	10	78199075	missense	probably benign
R7839:Trappc10	UTSW	10	78188812	missense	possibly damaging	0.84
R8298:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R8306:Trappc10	UTSW	10	78200626	missense	possibly damaging	0.54
R8814:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R9035:Trappc10	UTSW	10	78207889	unclassified	probably benign
R9075:Trappc10	UTSW	10	78204296	missense	possibly damaging	0.77
R9112:Trappc10	UTSW	10	78193367	missense	probably damaging	0.99
R9182:Trappc10	UTSW	10	78214630	missense	probably damaging	1.00
R9444:Trappc10	UTSW	10	78197778	missense	probably benign	0.10
R9801:Trappc10	UTSW	10	78209429	missense	probably benign	0.00
Z1177:Trappc10	UTSW	10	78217153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCCAAAGGAGCTTTGTAAATG -3'
(R):5'- TGCCTCTTACACAGAACCGTC -3'

Sequencing Primer
(F):5'- CCCAAAGGAGCTTTGTAAATGTTTTC -3'
(R):5'- AGAACCGTCTGCCCTCC -3'

Posted On

2016-06-06