Incidental Mutation 'R5022:Zfp62'
ID 389274
Institutional Source Beutler Lab
Gene Symbol Zfp62
Ensembl Gene ENSMUSG00000046311
Gene Name zinc finger protein 62
Synonyms
MMRRC Submission 042613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5022 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 49203292-49218816 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49215729 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 216 (S216T)
Ref Sequence ENSEMBL: ENSMUSP00000116045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061757] [ENSMUST00000109197] [ENSMUST00000109198] [ENSMUST00000133150] [ENSMUST00000136539] [ENSMUST00000136691] [ENSMUST00000137061] [ENSMUST00000150284] [ENSMUST00000151228] [ENSMUST00000180016]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061757
AA Change: S216T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056226
Gene: ENSMUSG00000046311
AA Change: S216T

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109197
AA Change: S216T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104820
Gene: ENSMUSG00000046311
AA Change: S216T

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109198
AA Change: S216T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104821
Gene: ENSMUSG00000046311
AA Change: S216T

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128932
Predicted Effect probably benign
Transcript: ENSMUST00000133150
Predicted Effect probably damaging
Transcript: ENSMUST00000136539
AA Change: S216T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116045
Gene: ENSMUSG00000046311
AA Change: S216T

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136691
Predicted Effect probably benign
Transcript: ENSMUST00000137061
Predicted Effect probably benign
Transcript: ENSMUST00000150284
Predicted Effect probably benign
Transcript: ENSMUST00000151228
SMART Domains Protein: ENSMUSP00000117774
Gene: ENSMUSG00000046311

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
Pfam:zf-C2H2_6 179 195 2.3e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157023
Predicted Effect possibly damaging
Transcript: ENSMUST00000180016
AA Change: S216T

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137583
Gene: ENSMUSG00000046311
AA Change: S216T

DomainStartEndE-ValueType
ZnF_C2H2 124 146 7.26e-3 SMART
ZnF_C2H2 152 174 7.26e-3 SMART
ZnF_C2H2 180 202 2.75e-3 SMART
ZnF_C2H2 208 230 2.71e-2 SMART
ZnF_C2H2 236 258 7.37e-4 SMART
ZnF_C2H2 264 286 2.27e-4 SMART
ZnF_C2H2 292 314 4.11e-2 SMART
ZnF_C2H2 320 342 1.03e-2 SMART
ZnF_C2H2 348 370 4.54e-4 SMART
ZnF_C2H2 376 398 4.47e-3 SMART
ZnF_C2H2 404 426 4.4e-2 SMART
ZnF_C2H2 432 454 2.43e-4 SMART
ZnF_C2H2 460 482 1.38e-3 SMART
ZnF_C2H2 488 510 2.79e-4 SMART
ZnF_C2H2 516 538 5.9e-3 SMART
ZnF_C2H2 544 566 3.39e-3 SMART
ZnF_C2H2 572 594 3.89e-3 SMART
ZnF_C2H2 600 622 5.5e-3 SMART
ZnF_C2H2 628 650 2.75e-3 SMART
ZnF_C2H2 656 678 3.63e-3 SMART
ZnF_C2H2 684 706 7.9e-4 SMART
ZnF_C2H2 712 734 8.34e-3 SMART
ZnF_C2H2 740 762 1.98e-4 SMART
ZnF_C2H2 768 790 1.53e-1 SMART
ZnF_C2H2 796 817 1.16e1 SMART
ZnF_C2H2 823 845 5.99e-4 SMART
Meta Mutation Damage Score 0.3543 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 (GRCm38) probably null Het
Abca15 T C 7: 120,346,096 (GRCm38) I465T probably damaging Het
Abca3 C T 17: 24,374,300 (GRCm38) R224C probably damaging Het
Abcb4 T A 5: 8,909,054 (GRCm38) probably null Het
Acan T C 7: 79,092,808 (GRCm38) probably null Het
Aebp2 G A 6: 140,637,730 (GRCm38) R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 (GRCm38) probably null Het
Ankib1 T A 5: 3,734,011 (GRCm38) I322F possibly damaging Het
AW551984 A T 9: 39,597,965 (GRCm38) N293K probably benign Het
BC028528 T A 3: 95,888,823 (GRCm38) probably benign Het
Bicc1 A G 10: 70,947,883 (GRCm38) S393P possibly damaging Het
Birc6 A G 17: 74,692,332 (GRCm38) Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 (GRCm38) R369G probably damaging Het
C1d T A 11: 17,266,674 (GRCm38) N135K probably benign Het
Ccdc148 G A 2: 58,827,632 (GRCm38) A453V probably damaging Het
Cd163 C T 6: 124,325,288 (GRCm38) T937I probably damaging Het
Celf2 C T 2: 6,607,847 (GRCm38) probably benign Het
Chga T C 12: 102,562,837 (GRCm38) W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 (GRCm38) S77C probably null Het
Crim1 T C 17: 78,280,129 (GRCm38) V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 (GRCm38) S116T probably damaging Het
Dlg5 T C 14: 24,136,622 (GRCm38) E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 (GRCm38) I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 (GRCm38) L355Q probably damaging Het
Exd2 T A 12: 80,496,790 (GRCm38) N582K probably damaging Het
Fbln1 G A 15: 85,237,626 (GRCm38) S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 (GRCm38) I340T possibly damaging Het
Fn1 T C 1: 71,624,179 (GRCm38) Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 (GRCm38) I2031V probably benign Het
Gm10803 A C 2: 93,564,172 (GRCm38) L96F probably damaging Het
Gm12169 T A 11: 46,528,532 (GRCm38) D58E probably damaging Het
Gm14569 T C X: 36,430,817 (GRCm38) D1413G probably benign Het
Gm15455 T C 1: 33,837,351 (GRCm38) noncoding transcript Het
Gm1818 G C 12: 48,555,535 (GRCm38) noncoding transcript Het
Gm4907 G A X: 23,907,241 (GRCm38) G327E probably damaging Het
Gm5039 T C 12: 88,321,301 (GRCm38) I61V probably benign Het
Gm5420 A T 10: 21,691,727 (GRCm38) noncoding transcript Het
Gm6803 A T 12: 88,018,711 (GRCm38) S21T unknown Het
Gm7104 A T 12: 88,285,759 (GRCm38) noncoding transcript Het
Gp2 A G 7: 119,449,114 (GRCm38) I427T probably damaging Het
Gpc4 G A X: 52,074,563 (GRCm38) R148C probably damaging Het
Gpr142 A C 11: 114,804,388 (GRCm38) S60R probably benign Het
Helz2 T C 2: 181,240,569 (GRCm38) R144G probably benign Het
Herc1 A T 9: 66,470,326 (GRCm38) K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 (GRCm38) A144S probably damaging Het
Irs2 A C 8: 10,987,012 (GRCm38) *1322G probably null Het
Keg1 A G 19: 12,719,157 (GRCm38) N288S probably damaging Het
Kif19a G A 11: 114,767,227 (GRCm38) M37I probably benign Het
Klhl1 G A 14: 96,136,706 (GRCm38) P635S probably benign Het
Klk14 G A 7: 43,692,077 (GRCm38) C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 (GRCm38) D25G probably damaging Het
Manea A T 4: 26,336,630 (GRCm38) Y215* probably null Het
Mdga2 C T 12: 66,470,760 (GRCm38) C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 (GRCm38) V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 (GRCm38) M582K probably damaging Het
Myh7b G C 2: 155,632,373 (GRCm38) R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 (GRCm38) Y239H probably damaging Het
Nat8 G A 6: 85,830,857 (GRCm38) T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 (GRCm38) A161S probably benign Het
Nexmif A T X: 104,087,350 (GRCm38) N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 (GRCm38) V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 (GRCm38) M92I probably benign Het
Olfr164 A T 16: 19,286,059 (GRCm38) V228D probably damaging Het
Olfr239 T C 17: 33,199,777 (GRCm38) F239S probably damaging Het
Olfr457 A T 6: 42,471,287 (GRCm38) V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 (GRCm38) P4L probably benign Het
Olfr727 T C 14: 50,127,012 (GRCm38) V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 (GRCm38) L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 (GRCm38) N776K probably benign Het
Pip5k1c G A 10: 81,310,889 (GRCm38) probably null Het
Plk4 G A 3: 40,802,077 (GRCm38) probably null Het
Prmt8 A G 6: 127,711,163 (GRCm38) Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 (GRCm38) probably benign Het
Ptpn21 G A 12: 98,679,407 (GRCm38) R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 (GRCm38) P312S possibly damaging Het
Rad21 A T 15: 51,966,706 (GRCm38) I503K probably benign Het
Rai14 A G 15: 10,574,506 (GRCm38) S789P probably damaging Het
Rbm26 C T 14: 105,144,252 (GRCm38) D486N probably damaging Het
Rnf20 A G 4: 49,642,016 (GRCm38) probably benign Het
Ros1 A G 10: 52,124,075 (GRCm38) V1118A possibly damaging Het
Sema3d A C 5: 12,584,956 (GRCm38) Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 (GRCm38) W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 (GRCm38) V900A probably damaging Het
Spats2l G T 1: 57,879,556 (GRCm38) V30L probably damaging Het
Spg21 A G 9: 65,475,949 (GRCm38) D139G probably damaging Het
Sun3 T C 11: 9,038,314 (GRCm38) T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 (GRCm38) S42T probably benign Het
Tep1 A G 14: 50,828,999 (GRCm38) Y2335H probably benign Het
Timm21 C A 18: 84,949,414 (GRCm38) V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 (GRCm38) N386K probably benign Het
Trappc10 G T 10: 78,217,160 (GRCm38) F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 (GRCm38) V91A probably benign Het
Ucp2 A T 7: 100,498,372 (GRCm38) N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 (GRCm38) S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 (GRCm38) probably null Het
Vmn2r105 T A 17: 20,208,414 (GRCm38) H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 (GRCm38) M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 (GRCm38) L601P probably damaging Het
Vps16 A G 2: 130,439,452 (GRCm38) S235G probably benign Het
Wap T C 11: 6,637,339 (GRCm38) probably benign Het
Wdr11 A G 7: 129,624,711 (GRCm38) I744M probably benign Het
Xiap T C X: 42,094,465 (GRCm38) F23L probably benign Het
Xkr7 A G 2: 153,054,380 (GRCm38) T385A probably benign Het
Zfp524 A T 7: 5,018,417 (GRCm38) I315F probably benign Het
Znfx1 T C 2: 167,039,826 (GRCm38) Y217C probably damaging Het
Other mutations in Zfp62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03342:Zfp62 APN 11 49,215,471 (GRCm38) nonsense probably null
R0416:Zfp62 UTSW 11 49,215,676 (GRCm38) missense probably damaging 1.00
R0540:Zfp62 UTSW 11 49,215,400 (GRCm38) missense probably benign
R0607:Zfp62 UTSW 11 49,215,400 (GRCm38) missense probably benign
R1119:Zfp62 UTSW 11 49,216,690 (GRCm38) missense probably damaging 0.99
R1230:Zfp62 UTSW 11 49,215,099 (GRCm38) missense probably damaging 0.96
R1644:Zfp62 UTSW 11 49,215,769 (GRCm38) missense probably damaging 0.99
R1710:Zfp62 UTSW 11 49,217,683 (GRCm38) missense probably benign
R1840:Zfp62 UTSW 11 49,216,388 (GRCm38) missense probably damaging 1.00
R1908:Zfp62 UTSW 11 49,216,220 (GRCm38) missense probably damaging 0.99
R3878:Zfp62 UTSW 11 49,215,133 (GRCm38) missense probably damaging 0.99
R4571:Zfp62 UTSW 11 49,215,742 (GRCm38) missense probably damaging 1.00
R4571:Zfp62 UTSW 11 49,215,741 (GRCm38) missense probably damaging 1.00
R4580:Zfp62 UTSW 11 49,216,272 (GRCm38) missense possibly damaging 0.91
R4631:Zfp62 UTSW 11 49,217,805 (GRCm38) makesense probably null
R5023:Zfp62 UTSW 11 49,215,729 (GRCm38) missense probably damaging 0.96
R5289:Zfp62 UTSW 11 49,217,148 (GRCm38) missense probably damaging 0.98
R5362:Zfp62 UTSW 11 49,216,612 (GRCm38) missense probably damaging 1.00
R5685:Zfp62 UTSW 11 49,216,217 (GRCm38) nonsense probably null
R6420:Zfp62 UTSW 11 49,216,513 (GRCm38) missense probably damaging 1.00
R6764:Zfp62 UTSW 11 49,215,169 (GRCm38) missense probably damaging 0.99
R7000:Zfp62 UTSW 11 49,216,379 (GRCm38) nonsense probably null
R7016:Zfp62 UTSW 11 49,215,937 (GRCm38) missense probably damaging 0.98
R7175:Zfp62 UTSW 11 49,216,753 (GRCm38) missense probably damaging 0.99
R7670:Zfp62 UTSW 11 49,215,076 (GRCm38) start gained probably benign
R7675:Zfp62 UTSW 11 49,216,020 (GRCm38) missense possibly damaging 0.75
R7686:Zfp62 UTSW 11 49,217,158 (GRCm38) missense probably damaging 1.00
R7801:Zfp62 UTSW 11 49,217,328 (GRCm38) missense possibly damaging 0.88
R8190:Zfp62 UTSW 11 49,216,075 (GRCm38) missense probably damaging 1.00
R8390:Zfp62 UTSW 11 49,215,192 (GRCm38) missense probably benign 0.02
R8401:Zfp62 UTSW 11 49,217,391 (GRCm38) missense probably damaging 1.00
R8479:Zfp62 UTSW 11 49,216,492 (GRCm38) missense probably damaging 0.98
R8735:Zfp62 UTSW 11 49,217,400 (GRCm38) missense probably damaging 1.00
R8809:Zfp62 UTSW 11 49,216,411 (GRCm38) missense probably damaging 0.98
R8972:Zfp62 UTSW 11 49,216,065 (GRCm38) missense possibly damaging 0.66
R9220:Zfp62 UTSW 11 49,215,248 (GRCm38) missense probably benign 0.17
R9261:Zfp62 UTSW 11 49,217,523 (GRCm38) missense probably benign 0.20
R9484:Zfp62 UTSW 11 49,217,281 (GRCm38) missense probably damaging 0.98
R9599:Zfp62 UTSW 11 49,215,715 (GRCm38) missense probably damaging 1.00
R9640:Zfp62 UTSW 11 49,215,631 (GRCm38) missense probably benign 0.21
R9781:Zfp62 UTSW 11 49,215,470 (GRCm38) nonsense probably null
X0011:Zfp62 UTSW 11 49,215,598 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACTTTTCGGAGTAGCTC -3'
(R):5'- TGGTCTTATGCTGAAGAAGAAGTG -3'

Sequencing Primer
(F):5'- GAGTAGCTCCAGTCTTCGAGTC -3'
(R):5'- ATGCACTATAAGGCCTGAGCTGTTC -3'
Posted On 2016-06-06