Incidental Mutation 'R5022:Exd2'
ID389281
Institutional Source Beutler Lab
Gene Symbol Exd2
Ensembl Gene ENSMUSG00000032705
Gene Nameexonuclease 3'-5' domain containing 2
Synonyms4930539P14Rik, Exdl2
MMRRC Submission 042613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5022 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80463095-80500227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80496790 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 582 (N582K)
Ref Sequence ENSEMBL: ENSMUSP00000043049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038185]
Predicted Effect probably damaging
Transcript: ENSMUST00000038185
AA Change: N582K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705
AA Change: N582K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 72 N/A INTRINSIC
35EXOc 105 291 3.8e-10 SMART
Blast:HNHc 438 492 1e-6 BLAST
low complexity region 517 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220239
Meta Mutation Damage Score 0.3624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 probably null Het
Abca15 T C 7: 120,346,096 I465T probably damaging Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abcb4 T A 5: 8,909,054 probably null Het
Acan T C 7: 79,092,808 probably null Het
Aebp2 G A 6: 140,637,730 R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 probably null Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
AW551984 A T 9: 39,597,965 N293K probably benign Het
BC028528 T A 3: 95,888,823 probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Birc6 A G 17: 74,692,332 Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 R369G probably damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Ccdc148 G A 2: 58,827,632 A453V probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Celf2 C T 2: 6,607,847 probably benign Het
Chga T C 12: 102,562,837 W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Crim1 T C 17: 78,280,129 V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 S116T probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 L355Q probably damaging Het
Fbln1 G A 15: 85,237,626 S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fn1 T C 1: 71,624,179 Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 I2031V probably benign Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gm5420 A T 10: 21,691,727 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gm7104 A T 12: 88,285,759 noncoding transcript Het
Gp2 A G 7: 119,449,114 I427T probably damaging Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpr142 A C 11: 114,804,388 S60R probably benign Het
Helz2 T C 2: 181,240,569 R144G probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Irs2 A C 8: 10,987,012 *1322G probably null Het
Keg1 A G 19: 12,719,157 N288S probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Klhl1 G A 14: 96,136,706 P635S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Manea A T 4: 26,336,630 Y215* probably null Het
Mdga2 C T 12: 66,470,760 C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 M582K probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 Y239H probably damaging Het
Nat8 G A 6: 85,830,857 T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 M92I probably benign Het
Olfr164 A T 16: 19,286,059 V228D probably damaging Het
Olfr239 T C 17: 33,199,777 F239S probably damaging Het
Olfr457 A T 6: 42,471,287 V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 P4L probably benign Het
Olfr727 T C 14: 50,127,012 V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 N776K probably benign Het
Pip5k1c G A 10: 81,310,889 probably null Het
Plk4 G A 3: 40,802,077 probably null Het
Prmt8 A G 6: 127,711,163 Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 probably benign Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 P312S possibly damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rai14 A G 15: 10,574,506 S789P probably damaging Het
Rbm26 C T 14: 105,144,252 D486N probably damaging Het
Rnf20 A G 4: 49,642,016 probably benign Het
Ros1 A G 10: 52,124,075 V1118A possibly damaging Het
Sema3d A C 5: 12,584,956 Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Spats2l G T 1: 57,879,556 V30L probably damaging Het
Spg21 A G 9: 65,475,949 D139G probably damaging Het
Sun3 T C 11: 9,038,314 T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 S42T probably benign Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 N386K probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ucp2 A T 7: 100,498,372 N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 probably null Het
Vmn2r105 T A 17: 20,208,414 H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 L601P probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Wap T C 11: 6,637,339 probably benign Het
Wdr11 A G 7: 129,624,711 I744M probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Exd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Exd2 APN 12 80476166 missense probably damaging 1.00
IGL00546:Exd2 APN 12 80480547 missense probably benign 0.05
IGL02964:Exd2 APN 12 80480528 missense probably damaging 0.99
IGL03036:Exd2 APN 12 80489411 missense probably damaging 1.00
R0304:Exd2 UTSW 12 80491240 unclassified probably benign
R0436:Exd2 UTSW 12 80490770 splice site probably benign
R1290:Exd2 UTSW 12 80484326 missense probably benign 0.00
R1772:Exd2 UTSW 12 80489479 missense probably benign 0.00
R2102:Exd2 UTSW 12 80480603 missense possibly damaging 0.78
R2104:Exd2 UTSW 12 80496801 missense probably benign 0.01
R2408:Exd2 UTSW 12 80484241 splice site probably benign
R3693:Exd2 UTSW 12 80480693 missense probably damaging 1.00
R4748:Exd2 UTSW 12 80480576 missense probably damaging 1.00
R4773:Exd2 UTSW 12 80475818 missense possibly damaging 0.46
R5057:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5179:Exd2 UTSW 12 80484344 missense probably damaging 1.00
R5377:Exd2 UTSW 12 80489448 missense probably damaging 1.00
R7246:Exd2 UTSW 12 80480535 missense probably damaging 1.00
R7761:Exd2 UTSW 12 80475772 missense probably damaging 0.98
R7776:Exd2 UTSW 12 80492560 missense probably damaging 1.00
RF013:Exd2 UTSW 12 80475932 frame shift probably null
RF015:Exd2 UTSW 12 80475917 intron probably benign
RF022:Exd2 UTSW 12 80475917 intron probably benign
RF023:Exd2 UTSW 12 80475915 intron probably benign
RF025:Exd2 UTSW 12 80475955 intron probably benign
RF029:Exd2 UTSW 12 80475946 frame shift probably null
RF035:Exd2 UTSW 12 80475900 intron probably benign
RF035:Exd2 UTSW 12 80475955 intron probably benign
RF039:Exd2 UTSW 12 80475941 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTTTGAGCCTGTATCCTACAC -3'
(R):5'- TTTCGGAGCAGCTTCTGATG -3'

Sequencing Primer
(F):5'- ATCCGTAATGAGATCTGATGCCC -3'
(R):5'- ATGGTTGTGGTCCACTGAC -3'
Posted On2016-06-06