Incidental Mutation 'R5022:Prpf4b'
ID 389289
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Name pre-mRNA processing factor 4B
Synonyms Prpk, Prp4k, Prp4
MMRRC Submission 042613-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5022 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 35059285-35090047 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 35067582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
AlphaFold Q61136
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: I137T
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: I137T

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221639
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: I137T
Meta Mutation Damage Score 0.2058 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 (GRCm39) probably null Het
Abca15 T C 7: 119,945,319 (GRCm39) I465T probably damaging Het
Abca3 C T 17: 24,593,274 (GRCm39) R224C probably damaging Het
Abcb4 T A 5: 8,959,054 (GRCm39) probably null Het
Acan T C 7: 78,742,556 (GRCm39) probably null Het
Aebp2 G A 6: 140,583,456 (GRCm39) R109Q possibly damaging Het
Agfg2 A T 5: 137,658,422 (GRCm39) probably null Het
Ankib1 T A 5: 3,784,011 (GRCm39) I322F possibly damaging Het
AW551984 A T 9: 39,509,261 (GRCm39) N293K probably benign Het
BC028528 T A 3: 95,796,135 (GRCm39) probably benign Het
Bicc1 A G 10: 70,783,713 (GRCm39) S393P possibly damaging Het
Birc6 A G 17: 74,999,327 (GRCm39) Y4656C probably damaging Het
Bmp3 A G 5: 99,020,683 (GRCm39) R369G probably damaging Het
C1d T A 11: 17,216,674 (GRCm39) N135K probably benign Het
Ccdc148 G A 2: 58,717,644 (GRCm39) A453V probably damaging Het
Cd163 C T 6: 124,302,247 (GRCm39) T937I probably damaging Het
Celf2 C T 2: 6,612,658 (GRCm39) probably benign Het
Chga T C 12: 102,529,096 (GRCm39) W358R probably damaging Het
Clec4b2 A T 6: 123,177,915 (GRCm39) S77C probably null Het
Crim1 T C 17: 78,587,558 (GRCm39) V221A possibly damaging Het
D630003M21Rik A T 2: 158,059,553 (GRCm39) S116T probably damaging Het
Dlg5 T C 14: 24,186,690 (GRCm39) E1847G probably damaging Het
Dmxl1 T A 18: 50,028,194 (GRCm39) I2206K probably damaging Het
Dusp7 T A 9: 106,250,940 (GRCm39) L355Q probably damaging Het
Eif1ad15 T C 12: 88,288,071 (GRCm39) I61V probably benign Het
Eif1ad16 A T 12: 87,985,481 (GRCm39) S21T unknown Het
Exd2 T A 12: 80,543,564 (GRCm39) N582K probably damaging Het
Fbln1 G A 15: 85,121,827 (GRCm39) S316N probably damaging Het
Fchsd1 A G 18: 38,097,863 (GRCm39) I340T possibly damaging Het
Fn1 T C 1: 71,663,338 (GRCm39) Y1050C probably damaging Het
Fsip2 A G 2: 82,809,773 (GRCm39) I2031V probably benign Het
Gm10803 A C 2: 93,394,517 (GRCm39) L96F probably damaging Het
Gm14569 T C X: 35,694,470 (GRCm39) D1413G probably benign Het
Gm15455 T C 1: 33,876,432 (GRCm39) noncoding transcript Het
Gm1818 G C 12: 48,602,318 (GRCm39) noncoding transcript Het
Gm5420 A T 10: 21,567,626 (GRCm39) noncoding transcript Het
Gm7104 A T 12: 88,252,529 (GRCm39) noncoding transcript Het
Gp2 A G 7: 119,048,337 (GRCm39) I427T probably damaging Het
Gpc4 G A X: 51,163,440 (GRCm39) R148C probably damaging Het
Gpr142 A C 11: 114,695,214 (GRCm39) S60R probably benign Het
Helz2 T C 2: 180,882,362 (GRCm39) R144G probably benign Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hnf4g G T 3: 3,709,647 (GRCm39) A144S probably damaging Het
Irs2 A C 8: 11,037,012 (GRCm39) *1322G probably null Het
Keg1 A G 19: 12,696,521 (GRCm39) N288S probably damaging Het
Kif19a G A 11: 114,658,053 (GRCm39) M37I probably benign Het
Klhl1 G A 14: 96,374,142 (GRCm39) P635S probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lsm11 T C 11: 45,835,666 (GRCm39) D25G probably damaging Het
Manea A T 4: 26,336,630 (GRCm39) Y215* probably null Het
Mdga2 C T 12: 66,517,534 (GRCm39) C100Y possibly damaging Het
Mthfd1 T A 12: 76,348,102 (GRCm39) M582K probably damaging Het
Mthfd1 T G 12: 76,341,148 (GRCm39) V480G probably damaging Het
Myh7b G C 2: 155,474,293 (GRCm39) R1669S possibly damaging Het
Nanos1 T C 19: 60,745,418 (GRCm39) Y239H probably damaging Het
Nat8 G A 6: 85,807,839 (GRCm39) T98I possibly damaging Het
Ndufs3 C A 2: 90,729,004 (GRCm39) A161S probably benign Het
Nexmif A T X: 103,130,956 (GRCm39) N320K probably damaging Het
Or10h1 T C 17: 33,418,751 (GRCm39) F239S probably damaging Het
Or2m12 A T 16: 19,104,809 (GRCm39) V228D probably damaging Het
Or2r3 A T 6: 42,448,221 (GRCm39) V297E possibly damaging Het
Or4c111 A G 2: 88,844,387 (GRCm39) V7A probably damaging Het
Or4c122 C T 2: 89,079,761 (GRCm39) M92I probably benign Het
Or4k15 T C 14: 50,364,469 (GRCm39) V145A possibly damaging Het
Or52e2 G A 7: 102,804,942 (GRCm39) P4L probably benign Het
Or6c69c T C 10: 129,910,462 (GRCm39) L61P probably damaging Het
Pcdhb14 T A 18: 37,583,223 (GRCm39) N776K probably benign Het
Pip5k1c G A 10: 81,146,723 (GRCm39) probably null Het
Plk4 G A 3: 40,756,512 (GRCm39) probably null Het
Prmt8 A G 6: 127,688,126 (GRCm39) Y231H possibly damaging Het
Ptpn21 G A 12: 98,645,666 (GRCm39) R1091C probably damaging Het
Pwwp2b C T 7: 138,835,494 (GRCm39) P312S possibly damaging Het
Rad21 A T 15: 51,830,102 (GRCm39) I503K probably benign Het
Rai14 A G 15: 10,574,592 (GRCm39) S789P probably damaging Het
Rbm26 C T 14: 105,381,688 (GRCm39) D486N probably damaging Het
Rnf20 A G 4: 49,642,016 (GRCm39) probably benign Het
Ros1 A G 10: 52,000,171 (GRCm39) V1118A possibly damaging Het
Sema3d A C 5: 12,634,923 (GRCm39) Y663S probably damaging Het
Serpina6 A G 12: 103,617,971 (GRCm39) W281R probably damaging Het
Slc8a3 A G 12: 81,246,332 (GRCm39) V900A probably damaging Het
Spats2l G T 1: 57,918,715 (GRCm39) V30L probably damaging Het
Spg21 A G 9: 65,383,231 (GRCm39) D139G probably damaging Het
Sun3 T C 11: 8,988,314 (GRCm39) T3A probably damaging Het
Tep1 A G 14: 51,066,456 (GRCm39) Y2335H probably benign Het
Tesl1 G A X: 23,773,480 (GRCm39) G327E probably damaging Het
Timd5 T A 11: 46,419,359 (GRCm39) D58E probably damaging Het
Timm21 C A 18: 84,967,539 (GRCm39) V112L possibly damaging Het
Tlk1 A T 2: 70,572,409 (GRCm39) N386K probably benign Het
Trappc10 G T 10: 78,052,994 (GRCm39) F260L possibly damaging Het
Trgv1 T A 13: 19,524,401 (GRCm39) S42T probably benign Het
Trmt112 T C 19: 6,888,121 (GRCm39) V91A probably benign Het
Ucp2 A T 7: 100,147,579 (GRCm39) N186I possibly damaging Het
Vmn1r119 A G 7: 20,746,245 (GRCm39) S46P probably benign Het
Vmn2r101 A T 17: 19,831,649 (GRCm39) probably null Het
Vmn2r105 T A 17: 20,428,676 (GRCm39) H800L probably damaging Het
Vmn2r69 T C 7: 85,060,367 (GRCm39) M406V possibly damaging Het
Vmn2r84 A G 10: 130,222,417 (GRCm39) L601P probably damaging Het
Vps16 A G 2: 130,281,372 (GRCm39) S235G probably benign Het
Wap T C 11: 6,587,339 (GRCm39) probably benign Het
Wdr11 A G 7: 129,226,435 (GRCm39) I744M probably benign Het
Xiap T C X: 41,183,342 (GRCm39) F23L probably benign Het
Xkr7 A G 2: 152,896,300 (GRCm39) T385A probably benign Het
Zfp524 A T 7: 5,021,416 (GRCm39) I315F probably benign Het
Zfp62 T A 11: 49,106,556 (GRCm39) S216T probably damaging Het
Znfx1 T C 2: 166,881,746 (GRCm39) Y217C probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 35,067,890 (GRCm39) missense probably benign 0.23
IGL00639:Prpf4b APN 13 35,083,156 (GRCm39) missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 35,078,465 (GRCm39) missense probably damaging 1.00
IGL01301:Prpf4b APN 13 35,068,274 (GRCm39) missense probably benign 0.23
IGL02027:Prpf4b APN 13 35,073,554 (GRCm39) missense probably benign 0.35
IGL02111:Prpf4b APN 13 35,067,944 (GRCm39) missense probably benign 0.23
IGL02256:Prpf4b APN 13 35,083,861 (GRCm39) missense probably damaging 0.98
IGL02590:Prpf4b APN 13 35,072,129 (GRCm39) unclassified probably benign
IGL03389:Prpf4b APN 13 35,084,439 (GRCm39) splice site probably benign
IGL03411:Prpf4b APN 13 35,079,342 (GRCm39) missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 35,068,274 (GRCm39) missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 35,068,274 (GRCm39) missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 35,083,825 (GRCm39) missense probably benign 0.01
R0114:Prpf4b UTSW 13 35,074,471 (GRCm39) splice site probably benign
R0157:Prpf4b UTSW 13 35,068,014 (GRCm39) unclassified probably benign
R1551:Prpf4b UTSW 13 35,078,426 (GRCm39) missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 35,076,133 (GRCm39) missense probably benign 0.09
R2105:Prpf4b UTSW 13 35,068,214 (GRCm39) unclassified probably benign
R2152:Prpf4b UTSW 13 35,084,402 (GRCm39) missense probably benign 0.04
R2432:Prpf4b UTSW 13 35,067,324 (GRCm39) unclassified probably benign
R3802:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3803:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3804:Prpf4b UTSW 13 35,067,665 (GRCm39) unclassified probably benign
R3982:Prpf4b UTSW 13 35,068,196 (GRCm39) unclassified probably benign
R4603:Prpf4b UTSW 13 35,072,147 (GRCm39) unclassified probably benign
R4633:Prpf4b UTSW 13 35,084,425 (GRCm39) missense probably damaging 1.00
R4649:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R4651:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R4653:Prpf4b UTSW 13 35,083,954 (GRCm39) missense probably benign 0.06
R5028:Prpf4b UTSW 13 35,083,958 (GRCm39) missense probably damaging 1.00
R5232:Prpf4b UTSW 13 35,067,573 (GRCm39) unclassified probably benign
R5313:Prpf4b UTSW 13 35,078,532 (GRCm39) missense probably damaging 1.00
R5440:Prpf4b UTSW 13 35,068,076 (GRCm39) unclassified probably benign
R5511:Prpf4b UTSW 13 35,068,037 (GRCm39) unclassified probably benign
R5863:Prpf4b UTSW 13 35,083,111 (GRCm39) missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 35,070,693 (GRCm39) missense probably benign 0.23
R6360:Prpf4b UTSW 13 35,085,416 (GRCm39) missense probably damaging 0.99
R6398:Prpf4b UTSW 13 35,084,354 (GRCm39) missense probably damaging 1.00
R6556:Prpf4b UTSW 13 35,080,015 (GRCm39) missense probably damaging 0.98
R6880:Prpf4b UTSW 13 35,078,436 (GRCm39) missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 35,085,477 (GRCm39) missense probably benign 0.02
R7148:Prpf4b UTSW 13 35,078,455 (GRCm39) missense probably benign 0.04
R7208:Prpf4b UTSW 13 35,067,994 (GRCm39) missense unknown
R7966:Prpf4b UTSW 13 35,085,428 (GRCm39) missense probably damaging 0.96
R8241:Prpf4b UTSW 13 35,079,974 (GRCm39) missense probably damaging 1.00
R8298:Prpf4b UTSW 13 35,072,166 (GRCm39) missense unknown
R9609:Prpf4b UTSW 13 35,068,032 (GRCm39) missense unknown
R9710:Prpf4b UTSW 13 35,083,870 (GRCm39) missense probably damaging 1.00
RF002:Prpf4b UTSW 13 35,068,219 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CGGAAAGAAGTTATCGAGGCTTC -3'
(R):5'- AGCTTGGTCTTGAGACTTGC -3'

Sequencing Primer
(F):5'- TTATCGAGGCTTCCGACAAAG -3'
(R):5'- GTCCGATCTGTGCCTGGTC -3'
Posted On 2016-06-06